Incidental Mutation 'R5222:Pmel'
ID402373
Institutional Source Beutler Lab
Gene Symbol Pmel
Ensembl Gene ENSMUSG00000025359
Gene Namepremelanosome protein
SynonymsPmel17, gp100, D10H12S53E, Si, D12S53Eh, gp87
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128704195-128720238 bp(+) (GRCm38)
Type of Mutationunclassified (3628 bp from exon)
DNA Base Change (assembly) A to G at 128718984 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026414] [ENSMUST00000054125] [ENSMUST00000217836] [ENSMUST00000219157] [ENSMUST00000219834]
Predicted Effect probably benign
Transcript: ENSMUST00000026414
SMART Domains Protein: ENSMUSP00000026414
Gene: ENSMUSG00000025357

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 4 93 6.9e-31 PFAM
EFh 115 143 3.82e0 SMART
EFh 160 188 1.29e-4 SMART
C1 207 254 2.29e-10 SMART
C1 269 320 6.91e-5 SMART
DAGKc 372 495 3.11e-62 SMART
DAGKa 515 696 4.1e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054125
AA Change: H582R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000051869
Gene: ENSMUSG00000025359
AA Change: H582R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
PKD 228 310 3.17e-7 SMART
low complexity region 326 348 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000217836
Predicted Effect probably null
Transcript: ENSMUST00000219157
Predicted Effect probably benign
Transcript: ENSMUST00000219834
Meta Mutation Damage Score 0.3959 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanocyte-specific type I transmembrane glycoprotein. The encoded protein is enriched in melanosomes, which are the melanin-producing organelles in melanocytes, and plays an essential role in the structural organization of premelanosomes. This protein is involved in generating internal matrix fibers that define the transition from Stage I to Stage II melanosomes. This protein undergoes a complex pattern of prosttranslational processing and modification that is essential to the proper functioning of the protein. A secreted form of this protein that is released by proteolytic ectodomain shedding may be used as a melanoma-specific serum marker. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
PHENOTYPE: This mutation affects the viability of melanoblasts, resulting in random occurrence of white, partially white or gray hairs, and fully pigmented hairs that together display as varying intensities of silvering. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Pmel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Pmel APN 10 128716089 missense possibly damaging 0.83
IGL01788:Pmel APN 10 128717832 missense probably damaging 1.00
IGL03205:Pmel APN 10 128716448 missense probably benign 0.05
R0288:Pmel UTSW 10 128714306 missense probably benign
R0944:Pmel UTSW 10 128715257 missense possibly damaging 0.82
R1220:Pmel UTSW 10 128714060 missense probably benign 0.01
R1429:Pmel UTSW 10 128718992 splice site probably null
R5689:Pmel UTSW 10 128716301 missense probably damaging 1.00
R5767:Pmel UTSW 10 128714381 missense probably damaging 0.99
R6145:Pmel UTSW 10 128715935 missense probably damaging 1.00
R7287:Pmel UTSW 10 128715226 nonsense probably null
R7410:Pmel UTSW 10 128716484 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CAATGTGTCTTTGGCTGACGC -3'
(R):5'- CTTCTCAAAGGCACCACAGG -3'

Sequencing Primer
(F):5'- GCCAGCACCCAACTTGTTG -3'
(R):5'- AGGAAGCCTGCAGCCCAG -3'
Posted On2016-07-22