Incidental Mutation 'R5295:Perm1'
ID405352
Institutional Source Beutler Lab
Gene Symbol Perm1
Ensembl Gene ENSMUSG00000078486
Gene NamePPARGC1 and ESRR induced regulator, muscle 1
Synonyms2310042D19Rik
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5295 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location156215868-156221307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156217518 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 173 (L173P)
Ref Sequence ENSEMBL: ENSMUSP00000101197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
Predicted Effect probably benign
Transcript: ENSMUST00000105571
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105572
AA Change: L173P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486
AA Change: L173P

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217885
Predicted Effect probably benign
Transcript: ENSMUST00000218699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Perm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Perm1 APN 4 156217661 missense probably damaging 0.99
IGL01970:Perm1 APN 4 156217661 missense probably damaging 0.99
IGL02143:Perm1 APN 4 156218043 missense probably benign 0.09
IGL02644:Perm1 APN 4 156218586 missense probably damaging 1.00
IGL02993:Perm1 APN 4 156217779 missense probably benign 0.20
PIT4366001:Perm1 UTSW 4 156218735 missense probably benign 0.11
R0052:Perm1 UTSW 4 156218115 missense probably damaging 1.00
R0105:Perm1 UTSW 4 156218225 missense probably benign 0.23
R0566:Perm1 UTSW 4 156217859 missense probably benign 0.10
R1184:Perm1 UTSW 4 156217314 missense probably damaging 1.00
R1208:Perm1 UTSW 4 156217002 start codon destroyed probably null 0.92
R1244:Perm1 UTSW 4 156217883 missense probably benign 0.09
R1724:Perm1 UTSW 4 156218072 missense possibly damaging 0.82
R1783:Perm1 UTSW 4 156218531 nonsense probably null
R1817:Perm1 UTSW 4 156218604 missense possibly damaging 0.59
R1892:Perm1 UTSW 4 156217883 missense probably benign 0.09
R1893:Perm1 UTSW 4 156217883 missense probably benign 0.09
R2106:Perm1 UTSW 4 156218879 missense probably damaging 1.00
R2567:Perm1 UTSW 4 156217118 missense probably damaging 0.99
R3752:Perm1 UTSW 4 156217946 missense probably benign 0.01
R3934:Perm1 UTSW 4 156219170 missense probably benign
R4509:Perm1 UTSW 4 156217586 missense probably benign 0.02
R4667:Perm1 UTSW 4 156220206 nonsense probably null
R4706:Perm1 UTSW 4 156217074 missense probably damaging 0.99
R4812:Perm1 UTSW 4 156218736 missense possibly damaging 0.59
R4979:Perm1 UTSW 4 156217577 missense probably benign 0.01
R5275:Perm1 UTSW 4 156217518 missense probably benign
R5425:Perm1 UTSW 4 156218295 missense probably benign 0.04
R6125:Perm1 UTSW 4 156217719 missense probably benign 0.00
R6573:Perm1 UTSW 4 156218673 missense probably damaging 1.00
R6721:Perm1 UTSW 4 156218319 missense probably benign 0.00
R6986:Perm1 UTSW 4 156218519 nonsense probably null
R7190:Perm1 UTSW 4 156219815 missense possibly damaging 0.84
R7561:Perm1 UTSW 4 156218760 missense probably benign
R7578:Perm1 UTSW 4 156218068 unclassified probably benign
R7769:Perm1 UTSW 4 156218068 unclassified probably benign
R7876:Perm1 UTSW 4 156217589 missense probably damaging 0.98
R7899:Perm1 UTSW 4 156218068 unclassified probably benign
R7934:Perm1 UTSW 4 156218068 unclassified probably benign
R7959:Perm1 UTSW 4 156217589 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCAGCTTAGACAGTGTCTG -3'
(R):5'- TAGAAAGATCCAAGCCTGACTC -3'

Sequencing Primer
(F):5'- ACAGTGTCTGTCCTGGCCAG -3'
(R):5'- CCATCTGTTCAGGACTCGTGGAG -3'
Posted On2016-07-22