Mutagenetix > Incidental Mutation

Incidental Mutation 'R5295:Gad1-ps'

405364

Institutional Source

Beutler Lab

Gene Symbol

Gad1-ps

Ensembl Gene

ENSMUSG00000090665

Gene Name

glutamate decarboxylase 1, pseudogene

Synonyms

Gad-1ps

MMRRC Submission

042878-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.263) question?

Stock #

R5295 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99443838-99447029 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

A to G at 99444889 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167243

SMART Domains

Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

Domain	Start	End	E-Value	Type
Pfam:Pyridoxal_deC	1	368	4.3e-153	PFAM
Pfam:Beta_elim_lyase	91	436	7.3e-8	PFAM
Pfam:Aminotran_5	130	370	4.7e-7	PFAM

Meta Mutation Damage Score

0.5596

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk2	C	T	18: 65,305,038	E1095K	probably damaging	Het
Alpl	T	C	4: 137,749,608	T245A	probably benign	Het
Ank2	T	C	3: 127,032,183	H378R	probably damaging	Het
Arhgef1	G	A	7: 24,919,352		probably null	Het
Atp5c1	T	C	2: 10,068,733	R10G	possibly damaging	Het
Cbln3	T	C	14: 55,883,463		probably null	Het
Ccr10	C	T	11: 101,174,285	V140M	possibly damaging	Het
Cep135	T	A	5: 76,593,204	H42Q	possibly damaging	Het
Commd5	C	A	15: 76,900,952	T183K	possibly damaging	Het
Dnajc16	T	C	4: 141,767,928	E493G	possibly damaging	Het
Ears2	T	C	7: 122,048,198	R288G	probably damaging	Het
Elovl4	G	A	9: 83,780,661	P273L	possibly damaging	Het
Fam186b	T	A	15: 99,283,874	I148F	probably damaging	Het
Fryl	T	C	5: 73,112,791	Y79C	probably damaging	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gm8882	T	G	6: 132,361,877	Q126P	unknown	Het
Ighv1-77	T	A	12: 115,861,908	S104C	probably damaging	Het
Kcnv1	T	C	15: 45,114,591	D17G	unknown	Het
Lmtk3	G	A	7: 45,791,298	D243N	probably damaging	Het
Lrrc7	T	A	3: 158,170,739	K571N	probably damaging	Het
Lsm7	T	C	10: 80,854,620	E32G	probably damaging	Het
Ly6f	A	G	15: 75,271,639	Q65R	probably benign	Het
Perm1	T	C	4: 156,217,518	L173P	probably benign	Het
Plvap	T	C	8: 71,511,670	Q16R	probably benign	Het
Prl7d1	A	T	13: 27,709,247	V227D	probably damaging	Het
Prss54	T	C	8: 95,564,478	T165A	probably damaging	Het
Psrc1	A	G	3: 108,386,359	I195V	probably benign	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Rnf213	A	T	11: 119,440,816	T2284S	probably benign	Het
Serpina3c	T	C	12: 104,148,378	E333G	probably damaging	Het
Serpinb6c	A	G	13: 33,893,817	F190S	probably damaging	Het
Sfmbt1	G	A	14: 30,774,029	D90N	probably damaging	Het
Tdh	T	C	14: 63,496,109	Y110C	probably damaging	Het
Tdrd9	T	A	12: 112,051,912	L1255*	probably null	Het
Trim41	TTCCTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCCTCC	11: 48,816,257		probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Zbtb2	T	C	10: 4,368,508	K506R	probably damaging	Het
Zmiz1	T	C	14: 25,656,347	L800P	probably damaging	Het
Znhit6	A	G	3: 145,600,493	D251G	probably benign	Het

Other mutations in Gad1-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00963:Gad1-ps	APN	10	99445448	exon	noncoding transcript
IGL01301:Gad1-ps	APN	10	99445151	exon	noncoding transcript
IGL01394:Gad1-ps	APN	10	99445562	exon	noncoding transcript
IGL02220:Gad1-ps	APN	10	99445322	exon	noncoding transcript
IGL02240:Gad1-ps	APN	10	99444958	exon	noncoding transcript
IGL03406:Gad1-ps	APN	10	99444779	exon	noncoding transcript
ANU18:Gad1-ps	UTSW	10	99445151	exon	noncoding transcript
R0305:Gad1-ps	UTSW	10	99444803	exon	noncoding transcript
R0446:Gad1-ps	UTSW	10	99445521	exon	noncoding transcript
R0538:Gad1-ps	UTSW	10	99444992	exon	noncoding transcript
R1511:Gad1-ps	UTSW	10	99445469	exon	noncoding transcript
R1734:Gad1-ps	UTSW	10	99445775	exon	noncoding transcript
R1745:Gad1-ps	UTSW	10	99445524	exon	noncoding transcript
R1886:Gad1-ps	UTSW	10	99445582	exon	noncoding transcript
R3111:Gad1-ps	UTSW	10	99444521	exon	noncoding transcript
R3617:Gad1-ps	UTSW	10	99445398	exon	noncoding transcript
R5042:Gad1-ps	UTSW	10	99445654	exon	noncoding transcript
R5223:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5234:Gad1-ps	UTSW	10	99445326	exon	noncoding transcript
R5275:Gad1-ps	UTSW	10	99444889	exon	noncoding transcript
R5334:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5335:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5336:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5337:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5396:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5397:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5399:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5428:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5429:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5431:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5661:Gad1-ps	UTSW	10	99445039	exon	noncoding transcript
R5667:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5671:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5885:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5886:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- ACCCGTGTTTGTTCTCATGG -3'
(R):5'- TCAAAAGCTCCGTAAACAGTCG -3'

Sequencing Primer
(F):5'- TGGAACAGATCACACTTAAGAAGATG -3'
(R):5'- TCCGTAAACAGTCGTGCCTG -3'

Posted On

2016-07-22