Incidental Mutation 'R5360:Mdm4'
ID424265
Institutional Source Beutler Lab
Gene Symbol Mdm4
Ensembl Gene ENSMUSG00000054387
Gene Nametransformed mouse 3T3 cell double minute 4
Synonyms4933417N07Rik, Mdmx
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5360 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132959484-133030561 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 132991658 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Lysine at position 490 (*490K)
Ref Sequence ENSEMBL: ENSMUSP00000140609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067398] [ENSMUST00000067429] [ENSMUST00000185398] [ENSMUST00000186617] [ENSMUST00000188090] [ENSMUST00000191212]
Predicted Effect probably null
Transcript: ENSMUST00000067398
AA Change: *491K
SMART Domains Protein: ENSMUSP00000068661
Gene: ENSMUSG00000054387
AA Change: *491K

DomainStartEndE-ValueType
Pfam:SWIB 26 96 3.7e-10 PFAM
low complexity region 281 295 N/A INTRINSIC
ZnF_RBZ 302 326 1.65e-2 SMART
RING 437 477 7.26e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067429
AA Change: *490K
SMART Domains Protein: ENSMUSP00000070411
Gene: ENSMUSG00000054387
AA Change: *490K

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185398
SMART Domains Protein: ENSMUSP00000140090
Gene: ENSMUSG00000054387

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186617
SMART Domains Protein: ENSMUSP00000140812
Gene: ENSMUSG00000054387

DomainStartEndE-ValueType
Pfam:SWIB 26 101 9.9e-15 PFAM
low complexity region 280 294 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188090
AA Change: *490K
SMART Domains Protein: ENSMUSP00000140609
Gene: ENSMUSG00000054387
AA Change: *490K

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190312
Predicted Effect probably benign
Transcript: ENSMUST00000191212
SMART Domains Protein: ENSMUSP00000140006
Gene: ENSMUSG00000054387

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.4e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of this gene or overexpression of the encoded protein has been linked to a range of human cancers. A pseudogene has been identified on the X chromosome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality, decreased cellular proliferation, and abnormal nervous system development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Mdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Mdm4 APN 1 132994547 missense probably benign 0.02
IGL03034:Mdm4 APN 1 133011071 missense probably damaging 1.00
IGL03099:Mdm4 APN 1 132992209 missense probably damaging 1.00
Isla_nublar UTSW 1 133012692 missense probably damaging 1.00
jurassic UTSW 1 133011115 missense probably damaging 0.96
Sun_island UTSW 1 133012651 missense probably damaging 1.00
R0630:Mdm4 UTSW 1 132991753 missense possibly damaging 0.47
R1170:Mdm4 UTSW 1 132991820 missense probably damaging 1.00
R1170:Mdm4 UTSW 1 133012692 missense probably damaging 1.00
R1774:Mdm4 UTSW 1 132996646 missense probably damaging 0.99
R1920:Mdm4 UTSW 1 133003800 missense probably benign 0.06
R2061:Mdm4 UTSW 1 133012651 missense probably damaging 1.00
R2212:Mdm4 UTSW 1 132994522 missense probably damaging 1.00
R3695:Mdm4 UTSW 1 132991993 missense probably benign 0.00
R3919:Mdm4 UTSW 1 132994568 missense possibly damaging 0.94
R5273:Mdm4 UTSW 1 132994582 missense probably benign
R6125:Mdm4 UTSW 1 132994510 missense possibly damaging 0.95
R6153:Mdm4 UTSW 1 132992107 missense probably damaging 1.00
R7028:Mdm4 UTSW 1 133003809 missense probably benign 0.09
R7234:Mdm4 UTSW 1 133011115 missense probably damaging 0.96
R7267:Mdm4 UTSW 1 132994573 missense probably benign 0.00
Z1088:Mdm4 UTSW 1 132994547 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGGTTCACAATTTGGAAGAAC -3'
(R):5'- AATGTCTTGAAGCCGTGTAGC -3'

Sequencing Primer
(F):5'- AGTATCTTCTCACTAATGAAACCCTC -3'
(R):5'- CATGTTTCCACTGTGCCA -3'
Posted On2016-08-04