Mutagenetix > Incidental Mutation

Incidental Mutation 'R5445:Dsc2'

427433

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

043010-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5445 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20035303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 700 (I700V)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039247
AA Change: I700V

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: I700V

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075214
AA Change: I700V

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: I700V

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000155407
AA Change: I99V

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331
AA Change: I99V

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430105I19Rik	T	C	2: 118,759,586	D259G	probably damaging	Het
Abcg5	A	T	17: 84,671,129	D300E	probably damaging	Het
Apbb1ip	T	C	2: 22,835,948	V244A	possibly damaging	Het
Arhgap32	T	C	9: 32,248,382	S232P	probably benign	Het
Atf7ip	G	A	6: 136,587,257	V833M	probably damaging	Het
Casp7	A	G	19: 56,433,338		probably null	Het
Celsr2	T	A	3: 108,392,658	E2911D	probably benign	Het
Cep350	T	C	1: 155,894,723	D1807G	probably benign	Het
Chrd	A	G	16: 20,738,910	T753A	possibly damaging	Het
Clasp2	A	G	9: 113,903,946	D971G	probably damaging	Het
Cnnm2	A	G	19: 46,877,288	T772A	possibly damaging	Het
Cntn1	A	T	15: 92,295,077	N687Y	probably damaging	Het
Col6a3	G	A	1: 90,782,039	R1812*	probably null	Het
Fam71d	G	A	12: 78,715,116	E185K	probably damaging	Het
Flt3	G	A	5: 147,355,095	Q540*	probably null	Het
Fmo4	T	A	1: 162,805,273	I170F	probably benign	Het
Fra10ac1	T	A	19: 38,219,462	D72V	possibly damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Gm13023	T	A	4: 143,795,137	V441E	possibly damaging	Het
Gm2381	T	G	7: 42,820,001	H233P	probably damaging	Het
Gm5148	T	A	3: 37,714,846	Q75L	probably damaging	Het
Gm8369	T	C	19: 11,504,806	V27A	possibly damaging	Het
Gpr157	T	C	4: 150,102,368	S318P	probably benign	Het
Hectd4	G	A	5: 121,266,274	V405M	probably benign	Het
Hemgn	T	C	4: 46,400,738	R41G	probably benign	Het
Hhipl1	T	A	12: 108,328,208	L791Q	probably damaging	Het
Hjurp	T	G	1: 88,266,316	K290T	probably benign	Het
Ifi207	T	C	1: 173,727,797	E773G	probably damaging	Het
Kcnh6	T	C	11: 106,023,859	Y697H	probably damaging	Het
Lonrf2	T	C	1: 38,807,153	T313A	probably benign	Het
Lrba	G	T	3: 86,368,595	V1757L	probably benign	Het
Lrrc24	T	C	15: 76,716,106	T278A	probably benign	Het
Ltbp2	T	C	12: 84,809,654	I679V	probably null	Het
Mapk4	G	T	18: 73,931,002	T383K	probably benign	Het
Mdn1	C	T	4: 32,723,690	P2542L	probably damaging	Het
Mia3	A	G	1: 183,336,022	V208A	probably benign	Het
Myo15	C	A	11: 60,520,777	C3234*	probably null	Het
Nlrp1b	G	T	11: 71,217,875	Q267K	probably benign	Het
Nphp3	A	G	9: 104,004,723	K37E	probably damaging	Het
Nwd2	T	C	5: 63,805,338	M755T	probably damaging	Het
Olfr482	A	G	7: 108,094,742	V276A	possibly damaging	Het
Olfr655	A	G	7: 104,596,821	F120S	probably damaging	Het
Olfr819	T	A	10: 129,966,289	H137L	probably benign	Het
Pdlim5	C	T	3: 142,352,734	R83K	probably null	Het
Plekha5	A	T	6: 140,552,733	R173*	probably null	Het
Rbms3	T	A	9: 117,251,785	D6V	possibly damaging	Het
Rhoq	A	T	17: 86,964,327	Y57F	probably benign	Het
Rrm1	A	T	7: 102,451,023	T204S	possibly damaging	Het
Slf1	A	T	13: 77,091,204	I447N	probably benign	Het
Smarcc2	T	A	10: 128,488,074		probably benign	Het
Spdye4c	C	T	2: 128,596,564	Q281*	probably null	Het
Tert	T	A	13: 73,644,284	M890K	probably benign	Het
Tln1	C	A	4: 43,543,905	R1198L	probably benign	Het
Tmco4	A	G	4: 139,020,867	M253V	probably damaging	Het
Usp19	G	T	9: 108,497,920	V782F	possibly damaging	Het
Usp33	T	A	3: 152,374,623	S464T	probably damaging	Het
Usp47	A	T	7: 112,074,721	Y397F	probably damaging	Het
Vmn1r12	A	G	6: 57,159,481	T144A	probably benign	Het
Vmn2r90	A	T	17: 17,734,124	H850L	probably benign	Het
Wdr66	C	T	5: 123,287,177	T294M	probably damaging	Het
Zfhx3	A	T	8: 108,956,210	Q3427L	unknown	Het
Zfp236	G	T	18: 82,682,156	Q63K	probably benign	Het
Zfp7	T	A	15: 76,890,854	C365*	probably null	Het
Zfp786	T	C	6: 47,819,685	E773G	probably damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTATACTCTGCTGACAAGACAGG -3'
(R):5'- ATTTGGATCCTATGCAGTTCCC -3'

Sequencing Primer
(F):5'- GTTCAGTAGATAAATGCGCTCGCC -3'
(R):5'- CCATTCGAGTTACAGACAGACTTGG -3'

Posted On

2016-09-01