Mutagenetix > Incidental Mutation

Incidental Mutation 'R5501:Atp1a4'

430592

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

043062-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5501 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 172246832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 285 (S285P)

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243]

AlphaFold

Q9WV27

Predicted Effect

probably damaging
Transcript: ENSMUST00000111243
AA Change: S285P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: S285P

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193316

Coding Region Coverage

1x: 98.2%
3x: 97.3%
10x: 95.1%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	A	C	8: 43,569,904	L183*	probably null	Het
Alox12e	G	T	11: 70,316,229	Q584K	probably benign	Het
Cdt1	C	T	8: 122,570,500	R311W	probably damaging	Het
Col25a1	A	G	3: 130,595,663	T632A	probably benign	Het
Coro6	T	C	11: 77,467,796	F227S	probably damaging	Het
Diras2	C	T	13: 52,507,750	V174M	probably benign	Het
Dopey1	A	G	9: 86,507,730	D569G	probably benign	Het
Dync1li2	A	G	8: 104,440,472		probably null	Het
Dysf	T	C	6: 84,087,818	V508A	probably damaging	Het
Edem1	T	C	6: 108,843,100		probably null	Het
Eef2k	A	G	7: 120,889,248	D452G	probably benign	Het
Espl1	A	G	15: 102,317,130	R1539G	possibly damaging	Het
Fat4	A	G	3: 38,887,215	S86G	probably benign	Het
Hpgd	A	T	8: 56,298,356	D73V	probably benign	Het
Ltb4r1	A	G	14: 55,768,082	N281D	probably damaging	Het
Map7	T	C	10: 20,276,202	S638P	unknown	Het
Mical1	G	A	10: 41,486,079	A934T	probably benign	Het
Micu3	C	A	8: 40,354,300		probably null	Het
Mmp24	T	A	2: 155,798,136	Y129N	probably damaging	Het
Mras	A	T	9: 99,411,546	Y14N	probably damaging	Het
Msmo1	A	T	8: 64,722,489	I169N	probably damaging	Het
Mtrr	G	T	13: 68,579,647	T60K	probably damaging	Het
Olfr1218	A	T	2: 89,054,886	L180*	probably null	Het
Olfr478	G	T	7: 108,032,153	Y63*	probably null	Het
Olfr849	T	A	9: 19,440,994	I27N	possibly damaging	Het
Pam	A	T	1: 97,840,365	C8*	probably null	Het
Phrf1	T	G	7: 141,259,921	S1169A	possibly damaging	Het
Pkd1l2	T	C	8: 117,065,830	T408A	probably damaging	Het
Plch1	G	T	3: 63,707,741	Q778K	probably damaging	Het
Ppp1r3a	A	G	6: 14,719,418	V499A	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Ryr3	C	A	2: 112,662,504	S3736I	possibly damaging	Het
Serpinb13	T	C	1: 106,982,185	F11L	possibly damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Smcp	A	G	3: 92,584,424	C39R	unknown	Het
Sox9	T	A	11: 112,783,859	L161Q	probably damaging	Het
Tanc2	T	C	11: 105,914,985		probably null	Het
Tlr3	C	T	8: 45,398,814	D349N	possibly damaging	Het
Tmem131l	G	T	3: 83,926,128	N809K	probably damaging	Het
Tyk2	T	C	9: 21,121,612	Y285C	probably damaging	Het
Usp15	T	A	10: 123,175,899	N98Y	probably damaging	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
R9545:Atp1a4	UTSW	1	172250897	missense	probably benign	0.35
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GTTTACTCACAGTGACAGTGGCC -3'
(R):5'- AAGTGTCAGGAACCTACCATG -3'

Sequencing Primer
(F):5'- CAGTGACAGTGGCCAGCAG -3'
(R):5'- GATTCTCCTAGCAAAACAACCAAAAG -3'

Posted On

2016-10-05