Incidental Mutation 'R4447:Atp1a4'
ID 328787
Institutional Source Beutler Lab
Gene Symbol Atp1a4
Ensembl Gene ENSMUSG00000007107
Gene Name ATPase, Na+/K+ transporting, alpha 4 polypeptide
Synonyms
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4447 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 172223513-172258414 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 172234431 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 709 (I709S)
Ref Sequence ENSEMBL: ENSMUSP00000106874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111243]
AlphaFold Q9WV27
Predicted Effect probably damaging
Transcript: ENSMUST00000111243
AA Change: I709S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: I709S

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Cation_ATPase_N 51 125 1.22e-14 SMART
Pfam:E1-E2_ATPase 144 375 2.6e-59 PFAM
Pfam:Hydrolase 380 738 8.1e-19 PFAM
Pfam:HAD 383 735 1.6e-17 PFAM
Pfam:Cation_ATPase 437 531 9.2e-25 PFAM
Pfam:Cation_ATPase_C 808 1017 1.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191616
Meta Mutation Damage Score 0.2274 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Atp1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Atp1a4 APN 1 172239806 missense probably damaging 1.00
IGL00924:Atp1a4 APN 1 172246772 missense probably damaging 1.00
IGL01288:Atp1a4 APN 1 172257907 missense possibly damaging 0.77
IGL01665:Atp1a4 APN 1 172246724 missense probably benign
IGL02156:Atp1a4 APN 1 172257962 missense probably benign
IGL02170:Atp1a4 APN 1 172234536 missense possibly damaging 0.94
IGL02228:Atp1a4 APN 1 172254885 missense possibly damaging 0.69
IGL02505:Atp1a4 APN 1 172235075 missense probably damaging 1.00
IGL02653:Atp1a4 APN 1 172251406 missense possibly damaging 0.81
IGL02792:Atp1a4 APN 1 172227299 critical splice donor site probably null
IGL02794:Atp1a4 APN 1 172244086 missense probably benign 0.13
IGL03102:Atp1a4 APN 1 172231151 missense probably damaging 1.00
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0276:Atp1a4 UTSW 1 172257901 missense probably damaging 1.00
R0309:Atp1a4 UTSW 1 172234987 missense probably damaging 1.00
R0525:Atp1a4 UTSW 1 172239688 splice site probably benign
R0615:Atp1a4 UTSW 1 172232060 splice site probably benign
R0730:Atp1a4 UTSW 1 172240207 splice site probably benign
R1412:Atp1a4 UTSW 1 172232009 missense probably damaging 0.97
R1652:Atp1a4 UTSW 1 172254903 missense probably damaging 1.00
R1898:Atp1a4 UTSW 1 172235048 missense probably damaging 0.99
R1968:Atp1a4 UTSW 1 172240164 missense probably benign
R2291:Atp1a4 UTSW 1 172244906 missense probably damaging 1.00
R2897:Atp1a4 UTSW 1 172246690 missense probably damaging 1.00
R2908:Atp1a4 UTSW 1 172234477 missense probably benign
R3119:Atp1a4 UTSW 1 172239826 missense probably damaging 0.99
R3731:Atp1a4 UTSW 1 172233961 missense probably damaging 1.00
R4602:Atp1a4 UTSW 1 172239765 missense probably damaging 1.00
R4670:Atp1a4 UTSW 1 172235000 missense probably benign 0.07
R4674:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4675:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4785:Atp1a4 UTSW 1 172254110 nonsense probably null
R4958:Atp1a4 UTSW 1 172231151 missense probably damaging 1.00
R5015:Atp1a4 UTSW 1 172254082 missense probably damaging 1.00
R5149:Atp1a4 UTSW 1 172232005 missense probably damaging 1.00
R5234:Atp1a4 UTSW 1 172227170 missense possibly damaging 0.73
R5501:Atp1a4 UTSW 1 172246832 missense probably damaging 1.00
R5682:Atp1a4 UTSW 1 172254163 missense probably damaging 0.99
R5872:Atp1a4 UTSW 1 172244408 missense probably damaging 1.00
R5933:Atp1a4 UTSW 1 172232274 missense possibly damaging 0.91
R6722:Atp1a4 UTSW 1 172258050 unclassified probably benign
R7087:Atp1a4 UTSW 1 172246702 missense probably damaging 1.00
R7122:Atp1a4 UTSW 1 172231936 missense possibly damaging 0.47
R7381:Atp1a4 UTSW 1 172240115 missense possibly damaging 0.70
R7431:Atp1a4 UTSW 1 172250907 missense probably benign 0.31
R8269:Atp1a4 UTSW 1 172232325 missense probably damaging 1.00
R8400:Atp1a4 UTSW 1 172234494 missense probably damaging 1.00
R8559:Atp1a4 UTSW 1 172251330 missense probably damaging 1.00
R8680:Atp1a4 UTSW 1 172250999 missense probably damaging 1.00
R8777:Atp1a4 UTSW 1 172232302 missense probably damaging 1.00
R8777-TAIL:Atp1a4 UTSW 1 172232302 missense probably damaging 1.00
R8867:Atp1a4 UTSW 1 172244924 missense probably damaging 0.99
R8869:Atp1a4 UTSW 1 172227123 missense probably benign
R9260:Atp1a4 UTSW 1 172246792 missense probably damaging 1.00
R9300:Atp1a4 UTSW 1 172239831 missense probably damaging 1.00
Z1176:Atp1a4 UTSW 1 172231954 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TTAACTGTGCTCAGCCCTG -3'
(R):5'- GTAGAGACTGCTGGAACCTGAG -3'

Sequencing Primer
(F):5'- CTTCTGTTCCTGTGAGCTATTTAAG -3'
(R):5'- CTGCTGGAACCTGAGGTGAG -3'
Posted On 2015-07-21