Incidental Mutation 'R5562:Col6a2'
ID436667
Institutional Source Beutler Lab
Gene Symbol Col6a2
Ensembl Gene ENSMUSG00000020241
Gene Namecollagen, type VI, alpha 2
SynonymsCol6a-2
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location76595762-76623630 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 76599675 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 909 (Q909*)
Ref Sequence ENSEMBL: ENSMUSP00000101053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001181] [ENSMUST00000105413]
Predicted Effect probably benign
Transcript: ENSMUST00000001181
SMART Domains Protein: ENSMUSP00000001181
Gene: ENSMUSG00000020241

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 59 246 9.55e-29 SMART
Pfam:Collagen 269 329 3.3e-11 PFAM
Pfam:Collagen 317 383 6.2e-10 PFAM
Pfam:Collagen 366 430 2.2e-8 PFAM
Pfam:Collagen 424 483 1.7e-9 PFAM
low complexity region 502 517 N/A INTRINSIC
Pfam:Collagen 546 605 1.1e-9 PFAM
VWA 628 816 7.51e-36 SMART
VWA 846 1029 3.97e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105413
AA Change: Q909*
SMART Domains Protein: ENSMUSP00000101053
Gene: ENSMUSG00000020241
AA Change: Q909*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 59 246 9.55e-29 SMART
Pfam:Collagen 269 330 5.2e-12 PFAM
Pfam:Collagen 316 384 6.1e-10 PFAM
Pfam:Collagen 364 431 1.4e-8 PFAM
Pfam:Collagen 424 483 5.3e-10 PFAM
Pfam:Collagen 475 542 3.3e-9 PFAM
Pfam:Collagen 531 605 7.4e-8 PFAM
VWA 628 816 7.51e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137365
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The product of this gene contains several domains similar to von Willebrand Factor type A domains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in this gene are associated with Bethlem myopathy and Ullrich scleroatonic muscular dystrophy. Three transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Col6a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Col6a2 APN 10 76614534 missense probably damaging 0.96
IGL01995:Col6a2 APN 10 76604842 splice site probably benign
IGL02005:Col6a2 APN 10 76610173 missense probably damaging 1.00
IGL02793:Col6a2 APN 10 76596310 missense possibly damaging 0.96
IGL03144:Col6a2 APN 10 76614425 missense probably benign
piddling UTSW 10 76608106 critical splice donor site probably null
R0137:Col6a2 UTSW 10 76596425 missense probably damaging 1.00
R0371:Col6a2 UTSW 10 76614473 missense probably benign 0.25
R0423:Col6a2 UTSW 10 76614917 missense possibly damaging 0.85
R0554:Col6a2 UTSW 10 76611161 critical splice donor site probably null
R0781:Col6a2 UTSW 10 76607740 missense probably benign 0.00
R0831:Col6a2 UTSW 10 76604105 missense probably damaging 1.00
R1110:Col6a2 UTSW 10 76607740 missense probably benign 0.00
R1499:Col6a2 UTSW 10 76603710 missense probably damaging 1.00
R1502:Col6a2 UTSW 10 76614678 missense probably benign 0.00
R1854:Col6a2 UTSW 10 76614812 missense probably damaging 0.98
R1878:Col6a2 UTSW 10 76614788 missense probably benign 0.00
R3410:Col6a2 UTSW 10 76603359 missense probably benign 0.17
R4110:Col6a2 UTSW 10 76606169 splice site probably null
R4242:Col6a2 UTSW 10 76608106 critical splice donor site probably null
R5603:Col6a2 UTSW 10 76596769 missense probably damaging 1.00
R5641:Col6a2 UTSW 10 76613278 missense probably damaging 1.00
R5681:Col6a2 UTSW 10 76609251 splice site probably null
R5707:Col6a2 UTSW 10 76611031 missense possibly damaging 0.95
R5735:Col6a2 UTSW 10 76599893 missense probably benign 0.32
R5789:Col6a2 UTSW 10 76604389 missense probably damaging 1.00
R6134:Col6a2 UTSW 10 76607144 missense probably damaging 0.97
R6156:Col6a2 UTSW 10 76604170 missense possibly damaging 0.92
R6208:Col6a2 UTSW 10 76615057 missense possibly damaging 0.88
R6296:Col6a2 UTSW 10 76611049 missense probably damaging 1.00
R6328:Col6a2 UTSW 10 76614378 missense possibly damaging 0.67
R6329:Col6a2 UTSW 10 76599828 missense probably benign 0.01
R6722:Col6a2 UTSW 10 76614558 missense probably damaging 0.98
R7012:Col6a2 UTSW 10 76614677 missense possibly damaging 0.95
R7091:Col6a2 UTSW 10 76615091 missense unknown
R7422:Col6a2 UTSW 10 76603336 nonsense probably null
R7655:Col6a2 UTSW 10 76607756 missense probably benign 0.00
R7656:Col6a2 UTSW 10 76607756 missense probably benign 0.00
R7802:Col6a2 UTSW 10 76603798 missense probably damaging 1.00
R8156:Col6a2 UTSW 10 76596791 missense possibly damaging 0.91
RF020:Col6a2 UTSW 10 76606209 critical splice acceptor site probably null
Z1177:Col6a2 UTSW 10 76596350 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGTGGGCCTCCAATCAC -3'
(R):5'- TCCGCACGGAAGAGGGTC -3'

Sequencing Primer
(F):5'- GGACAGGTTCCTAGGTTCCTAC -3'
(R):5'- GTCCGGACCCCACCTTC -3'
Posted On2016-10-24