Incidental Mutation 'R5652:Tcerg1l'
ID441485
Institutional Source Beutler Lab
Gene Symbol Tcerg1l
Ensembl Gene ENSMUSG00000091002
Gene Nametranscription elongation regulator 1-like
Synonyms5730476P14Rik
MMRRC Submission 043298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5652 (G1)
Quality Score210
Status Not validated
Chromosome7
Chromosomal Location138208974-138397730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138280046 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 305 (R305C)
Ref Sequence ENSEMBL: ENSMUSP00000124476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160436]
Predicted Effect probably damaging
Transcript: ENSMUST00000160436
AA Change: R305C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124476
Gene: ENSMUSG00000091002
AA Change: R305C

DomainStartEndE-ValueType
low complexity region 6 44 N/A INTRINSIC
low complexity region 52 97 N/A INTRINSIC
WW 146 178 2.11e1 SMART
low complexity region 235 249 N/A INTRINSIC
WW 344 376 3.29e-4 SMART
low complexity region 402 415 N/A INTRINSIC
FF 454 507 4.57e-12 SMART
FF 520 574 1.53e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162222
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,424,490 T135A probably benign Het
Abcc4 T C 14: 118,618,927 I334V probably benign Het
Adamts5 C T 16: 85,899,268 A334T probably damaging Het
Adcy4 G C 14: 55,773,443 F672L probably benign Het
Adgrl1 A G 8: 83,929,815 Y254C probably damaging Het
Adnp2 A G 18: 80,130,850 S115P probably damaging Het
Aox1 A T 1: 58,095,197 S1110C probably damaging Het
Arhgap44 G T 11: 65,024,238 N401K probably damaging Het
Atp23 A T 10: 126,899,625 N63K possibly damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr2 T C 3: 108,396,735 D2364G probably null Het
Celsr3 G A 9: 108,838,472 D2116N probably benign Het
Cenpf A G 1: 189,657,082 S1518P probably damaging Het
Clcn3 C A 8: 60,919,353 V758L possibly damaging Het
Ctsf T C 19: 4,858,477 L288P probably damaging Het
Cwh43 A G 5: 73,418,141 T334A probably damaging Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dennd1a A G 2: 37,801,126 I260T probably benign Het
Dgkh T C 14: 78,627,761 H47R probably damaging Het
Dync1h1 G A 12: 110,665,988 V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 M66K probably benign Het
Fam186a T G 15: 99,945,372 Y997S possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fat4 C T 3: 39,002,968 T4271I probably damaging Het
Fdxacb1 T A 9: 50,768,405 L41Q probably damaging Het
Fgfr2 C T 7: 130,261,863 V18M probably damaging Het
Gpa33 A C 1: 166,165,145 probably null Het
Gpr1 A G 1: 63,183,467 V203A probably benign Het
Gpr107 A G 2: 31,185,589 I371V probably benign Het
Hectd2 T C 19: 36,604,320 V420A probably damaging Het
Hist1h1t A G 13: 23,696,236 K124R probably benign Het
Iglc3 A G 16: 19,065,670 probably benign Het
Igtp A G 11: 58,206,629 T209A probably benign Het
Itgb7 T A 15: 102,216,203 N793I possibly damaging Het
Kansl1 G A 11: 104,338,166 R870C probably damaging Het
Kcnh6 C T 11: 106,008,985 R27C probably damaging Het
Kif2b T A 11: 91,575,830 E542D possibly damaging Het
Klhl24 C A 16: 20,120,247 Y517* probably null Het
Klhl25 A G 7: 75,866,147 D267G probably benign Het
Krr1 C A 10: 111,977,383 F195L possibly damaging Het
Lsr C T 7: 30,959,031 G95D probably damaging Het
Med15 A T 16: 17,655,191 I504N probably damaging Het
Mug1 A G 6: 121,840,181 R70G probably benign Het
Mypn T A 10: 63,135,801 Q820L probably damaging Het
Nlrp4f A T 13: 65,182,989 H863Q probably benign Het
Nudt9 G A 5: 104,059,780 V213M probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr828 A G 9: 18,815,626 S223P probably damaging Het
Olfr891 T C 9: 38,180,815 T3A probably benign Het
Olfr987 T A 2: 85,331,373 N175I probably damaging Het
Orc2 A G 1: 58,466,072 F475L probably damaging Het
Oxa1l T A 14: 54,366,832 L183* probably null Het
Pcdh20 T C 14: 88,467,324 T847A probably damaging Het
Pcdha6 G A 18: 36,968,836 probably null Het
Pip5k1a T C 3: 95,067,439 N376S probably benign Het
Pkd1l1 T C 11: 8,909,889 E573G probably benign Het
Pkp1 T A 1: 135,882,597 probably null Het
Pum1 T C 4: 130,764,127 I643T possibly damaging Het
Rapgef3 A G 15: 97,758,437 S328P probably benign Het
Raver1 A G 9: 21,090,312 V75A probably damaging Het
Rbm28 T C 6: 29,135,409 E511G probably damaging Het
Satb1 T A 17: 51,742,795 T544S probably damaging Het
Sdcbp2 T C 2: 151,589,215 V248A probably benign Het
Sema7a A G 9: 57,960,659 D506G probably damaging Het
Sept8 A G 11: 53,537,217 E286G probably damaging Het
Sh3pxd2b A G 11: 32,422,812 I660V probably damaging Het
Stk38l G T 6: 146,773,328 D364Y possibly damaging Het
Sycp2 T C 2: 178,358,705 probably null Het
Tbc1d31 T A 15: 57,951,666 S580T probably damaging Het
Tek T A 4: 94,855,324 Y859N probably damaging Het
Tjp1 A T 7: 65,312,443 probably null Het
Tmem132d A T 5: 127,784,795 I754N possibly damaging Het
Togaram1 G A 12: 65,016,650 V1580I probably benign Het
Troap A G 15: 99,082,264 T442A probably benign Het
Ttn A T 2: 76,881,753 probably benign Het
Twnk T A 19: 45,007,293 V55E possibly damaging Het
Uggt1 A T 1: 36,216,153 Y225* probably null Het
Vmn2r109 A G 17: 20,540,519 *859Q probably null Het
Vmn2r17 A T 5: 109,429,564 I494L probably benign Het
Vmn2r88 T C 14: 51,418,572 V746A probably damaging Het
Yae1d1 A G 13: 17,991,706 L57P probably damaging Het
Zfp26 G A 9: 20,437,841 R476* probably null Het
Zmynd8 T A 2: 165,807,698 Q816L probably damaging Het
Zswim8 A T 14: 20,713,427 H414L possibly damaging Het
Other mutations in Tcerg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Tcerg1l APN 7 138209804 missense probably damaging 0.99
IGL01402:Tcerg1l APN 7 138259839 missense probably damaging 0.98
IGL01510:Tcerg1l APN 7 138394305 splice site probably benign
IGL01638:Tcerg1l APN 7 138280076 missense probably damaging 1.00
IGL01710:Tcerg1l APN 7 138395060 missense possibly damaging 0.81
IGL02547:Tcerg1l APN 7 138248371 critical splice donor site probably null
IGL02887:Tcerg1l APN 7 138229890 missense probably damaging 1.00
IGL03105:Tcerg1l APN 7 138248444 splice site probably benign
IGL03348:Tcerg1l APN 7 138213371 missense probably damaging 0.97
R0378:Tcerg1l UTSW 7 138276655 missense probably benign 0.01
R1474:Tcerg1l UTSW 7 138280075 missense probably damaging 0.99
R1589:Tcerg1l UTSW 7 138361767 missense probably damaging 0.99
R1658:Tcerg1l UTSW 7 138394180 missense probably damaging 0.98
R1792:Tcerg1l UTSW 7 138361866 missense probably benign 0.07
R1807:Tcerg1l UTSW 7 138395097 missense probably benign 0.34
R2920:Tcerg1l UTSW 7 138248379 missense probably damaging 0.99
R3148:Tcerg1l UTSW 7 138259867 missense probably benign
R4106:Tcerg1l UTSW 7 138259944 missense probably damaging 0.99
R4180:Tcerg1l UTSW 7 138276676 critical splice acceptor site probably null
R4241:Tcerg1l UTSW 7 138397632 missense unknown
R4898:Tcerg1l UTSW 7 138218057 missense probably damaging 0.99
R6646:Tcerg1l UTSW 7 138395183 splice site probably null
R6824:Tcerg1l UTSW 7 138394115 critical splice donor site probably null
R7414:Tcerg1l UTSW 7 138218057 missense probably damaging 0.97
R7490:Tcerg1l UTSW 7 138259828 missense probably damaging 1.00
R8810:Tcerg1l UTSW 7 138209797 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGCCAGCCTGTAGTTCAGAG -3'
(R):5'- ACTCAGCATCAGGGTTACATTGTC -3'

Sequencing Primer
(F):5'- CCAGCCTGTAGTTCAGAGAAGACTG -3'
(R):5'- GCATCAGGGTTACATTGTCATTAGAC -3'
Posted On2016-11-08