Incidental Mutation 'R5663:Helb'
ID444213
Institutional Source Beutler Lab
Gene Symbol Helb
Ensembl Gene ENSMUSG00000020228
Gene Namehelicase (DNA) B
SynonymsD10Ertd664e
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location120083608-120112987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120105793 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 330 (I330T)
Ref Sequence ENSEMBL: ENSMUSP00000116954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020449] [ENSMUST00000154501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020449
AA Change: I330T

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020449
Gene: ENSMUSG00000020228
AA Change: I330T

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 661 4.8e-24 PFAM
Pfam:UvrD_C_2 855 901 2.3e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000154501
AA Change: I330T

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116954
Gene: ENSMUSG00000020228
AA Change: I330T

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 546 1.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent ATPase which catalyzes the unwinding of DNA necessary for DNA replication, repair, recombination, and transcription. This gene is thought to function specifically during the S phase entry of the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous knockout MEFs display increased DNA end resection, resulting in increased level of single-strand DNA formation at double-strand DNA breaks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Helb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Helb APN 10 120098245 missense possibly damaging 0.88
IGL00516:Helb APN 10 120105424 missense probably damaging 1.00
IGL00924:Helb APN 10 120110984 missense probably benign 0.01
IGL00971:Helb APN 10 120094263 missense possibly damaging 0.50
IGL01142:Helb APN 10 120111144 missense probably damaging 1.00
IGL01483:Helb APN 10 120111138 missense probably damaging 1.00
IGL01688:Helb APN 10 120108980 missense probably damaging 0.99
IGL01860:Helb APN 10 120102833 missense probably damaging 0.97
IGL02298:Helb APN 10 120101526 missense probably damaging 1.00
IGL02501:Helb APN 10 120102788 missense possibly damaging 0.96
IGL02554:Helb APN 10 120089712 missense probably damaging 1.00
IGL02810:Helb APN 10 120091703 missense possibly damaging 0.48
IGL02902:Helb APN 10 120089485 missense probably benign 0.00
IGL03405:Helb APN 10 120089796 missense probably damaging 1.00
R0004:Helb UTSW 10 120108981 missense probably damaging 1.00
R0092:Helb UTSW 10 120089808 missense probably damaging 1.00
R0436:Helb UTSW 10 120094212 splice site probably benign
R0850:Helb UTSW 10 120105367 missense probably damaging 1.00
R1423:Helb UTSW 10 120108966 missense probably damaging 0.99
R1663:Helb UTSW 10 120105433 missense probably damaging 1.00
R1756:Helb UTSW 10 120094242 missense probably damaging 0.96
R1812:Helb UTSW 10 120089566 nonsense probably null
R1976:Helb UTSW 10 120094263 missense possibly damaging 0.50
R2049:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2063:Helb UTSW 10 120105766 missense probably benign
R2141:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2180:Helb UTSW 10 120105448 missense probably benign 0.02
R2432:Helb UTSW 10 120105537 missense probably benign 0.01
R3030:Helb UTSW 10 120089582 nonsense probably null
R3874:Helb UTSW 10 120106037 missense probably benign 0.31
R3978:Helb UTSW 10 120089625 missense probably benign
R4731:Helb UTSW 10 120094288 critical splice acceptor site probably null
R4734:Helb UTSW 10 120084849 missense probably benign
R4748:Helb UTSW 10 120084849 missense probably benign
R4749:Helb UTSW 10 120084849 missense probably benign
R4840:Helb UTSW 10 120084858 missense probably benign 0.33
R4977:Helb UTSW 10 120110881 missense probably benign 0.01
R5149:Helb UTSW 10 120105743 missense probably benign 0.39
R5220:Helb UTSW 10 120101486 missense probably damaging 1.00
R5447:Helb UTSW 10 120102901 missense possibly damaging 0.88
R5637:Helb UTSW 10 120105448 missense probably benign 0.02
R5660:Helb UTSW 10 120111079 nonsense probably null
R5806:Helb UTSW 10 120092519 missense probably damaging 1.00
R5951:Helb UTSW 10 120091748 missense possibly damaging 0.91
R6010:Helb UTSW 10 120105883 missense probably damaging 1.00
R6183:Helb UTSW 10 120112998 splice site probably null
R6578:Helb UTSW 10 120111181 missense probably damaging 1.00
R6642:Helb UTSW 10 120084930 missense probably benign 0.17
R6666:Helb UTSW 10 120084951 missense probably damaging 0.99
R6705:Helb UTSW 10 120089811 splice site probably null
R6746:Helb UTSW 10 120105468 missense probably damaging 1.00
R7114:Helb UTSW 10 120105256 missense probably benign 0.09
R7396:Helb UTSW 10 120089571 missense probably benign
R7422:Helb UTSW 10 120108894 missense probably damaging 1.00
R7508:Helb UTSW 10 120105283 missense probably benign 0.04
R7509:Helb UTSW 10 120089814 missense probably damaging 1.00
R7746:Helb UTSW 10 120095102 missense probably null 1.00
R8058:Helb UTSW 10 120105578 missense probably benign 0.00
R8074:Helb UTSW 10 120089416 missense probably benign 0.00
R8348:Helb UTSW 10 120102886 missense probably damaging 1.00
R8428:Helb UTSW 10 120091617 missense probably damaging 1.00
R8448:Helb UTSW 10 120102886 missense probably damaging 1.00
R8710:Helb UTSW 10 120105967 missense probably damaging 1.00
R8751:Helb UTSW 10 120089507 missense probably benign 0.01
R8815:Helb UTSW 10 120112787 missense possibly damaging 0.71
R8822:Helb UTSW 10 120105484 missense probably benign 0.01
Z1177:Helb UTSW 10 120092690 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCACTTCCTGGATCGTTGG -3'
(R):5'- ATGAAACTAGTGCGCTGTGAG -3'

Sequencing Primer
(F):5'- CCTGGATCGTTGGGCTTTGC -3'
(R):5'- ACAGCGTTCAGTCAGTGC -3'
Posted On2016-11-09