Incidental Mutation 'R5758:Acan'
ID445140
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
MMRRC Submission 043203-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5758 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79101214 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1911 (E1911V)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032835
AA Change: E1911V

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: E1911V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206779
AA Change: E488V
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,536 N2973D probably damaging Het
Adamts20 T C 15: 94,394,650 N193S probably benign Het
AF067063 T C 13: 119,828,255 D135G probably damaging Het
Arhgap28 T C 17: 67,873,159 D81G probably benign Het
Calhm3 A G 19: 47,151,751 V301A probably damaging Het
Celsr1 C T 15: 85,941,264 G1556D probably benign Het
Cfap221 A G 1: 119,934,558 L598P probably benign Het
Col6a6 T C 9: 105,761,518 probably null Het
Dmxl2 T A 9: 54,472,964 I142F probably benign Het
Dpy19l4 C T 4: 11,276,886 V338M probably damaging Het
Dpys A C 15: 39,826,999 D319E possibly damaging Het
Dsc3 A G 18: 19,989,534 V111A probably damaging Het
Galnt5 T C 2: 57,998,430 V14A probably benign Het
Hebp2 C A 10: 18,544,407 V93L probably damaging Het
Igkv8-21 A T 6: 70,315,025 S78T possibly damaging Het
Jak2 T A 19: 29,309,643 D1036E probably damaging Het
Kazn A G 4: 142,141,671 probably null Het
Kif9 T C 9: 110,489,879 V143A probably damaging Het
Lhcgr T C 17: 88,742,548 I517V probably damaging Het
Llgl1 T C 11: 60,708,567 F458S probably damaging Het
Mrgprb3 C A 7: 48,643,319 M161I probably benign Het
Muc5b A T 7: 141,858,983 I1889F unknown Het
Mysm1 A G 4: 94,952,361 V606A probably damaging Het
Nipal3 T C 4: 135,452,563 D348G probably benign Het
Olfml2b G A 1: 170,669,264 probably null Het
Olfr467 T C 7: 107,814,815 V77A probably damaging Het
Olfr497 T A 7: 108,423,162 V197D probably benign Het
Orc5 T C 5: 22,529,258 D176G possibly damaging Het
Rapgef6 A G 11: 54,668,644 N1041S probably damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Sar1a A G 10: 61,685,072 Y22C probably benign Het
Shcbp1 T C 8: 4,749,355 probably null Het
Smim17 C T 7: 6,424,789 H25Y possibly damaging Het
Trim10 C T 17: 36,877,152 T420I possibly damaging Het
Trip13 G T 13: 73,937,495 S29R probably benign Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Uckl1 C A 2: 181,569,953 G420C probably damaging Het
Vangl1 A T 3: 102,184,092 V226D probably damaging Het
Zdhhc17 A G 10: 110,944,395 *633Q probably null Het
Zfhx4 A G 3: 5,402,620 K2613E probably damaging Het
Zfp236 G A 18: 82,671,709 T215M probably damaging Het
Zfp563 A G 17: 33,104,920 H163R probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCATCACAGAGTCCGAGTG -3'
(R):5'- AAGAACTCGGCATGACGCTC -3'

Sequencing Primer
(F):5'- AGAGTCCGAGTGGGCCC -3'
(R):5'- ATGACGCTCAGTGCTTGC -3'
Posted On2016-11-21