Incidental Mutation 'R5791:Mab21l2'
ID446962
Institutional Source Beutler Lab
Gene Symbol Mab21l2
Ensembl Gene ENSMUSG00000057777
Gene Namemab-21-like 2 (C. elegans)
Synonyms
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location86545581-86548629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86546737 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 319 (Y319H)
Ref Sequence ENSEMBL: ENSMUSP00000076729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077524] [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000195524] [ENSMUST00000212390]
Predicted Effect probably damaging
Transcript: ENSMUST00000077524
AA Change: Y319H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076729
Gene: ENSMUSG00000057777
AA Change: Y319H

DomainStartEndE-ValueType
Mab-21 61 347 1.61e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107635
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191695
Predicted Effect probably benign
Transcript: ENSMUST00000192145
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194674
Predicted Effect probably benign
Transcript: ENSMUST00000194759
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195398
Predicted Effect probably benign
Transcript: ENSMUST00000195524
SMART Domains Protein: ENSMUSP00000141734
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
Pfam:PH_BEACH 3 76 3.6e-20 PFAM
Beach 107 384 2.87e-207 SMART
WD40 482 519 7.4e0 SMART
WD40 522 565 1.72e0 SMART
WD40 581 620 3.99e-1 SMART
WD40 664 702 1.79e-1 SMART
WD40 705 744 4.28e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212390
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the C. elegans MAB-21 cell fate-determining gene, a downstream target of transforming growth factor-beta signaling. It is thought that this gene may be involved in neural development. The protein encoded by this gene is primarily nuclear, although some cytoplasmic localization has been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in omphalocele and defects in ventral body wall formation resulting in death at mid-gestation. Mutants have impaired development of the retina and lens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Mab21l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Mab21l2 APN 3 86546817 missense possibly damaging 0.67
IGL02143:Mab21l2 APN 3 86547255 missense possibly damaging 0.85
IGL02570:Mab21l2 APN 3 86547224 missense possibly damaging 0.79
R0401:Mab21l2 UTSW 3 86546989 missense probably benign 0.00
R1744:Mab21l2 UTSW 3 86546904 missense possibly damaging 0.58
R2088:Mab21l2 UTSW 3 86547009 missense probably damaging 1.00
R2504:Mab21l2 UTSW 3 86547555 missense probably damaging 1.00
R3825:Mab21l2 UTSW 3 86546904 missense possibly damaging 0.58
R4361:Mab21l2 UTSW 3 86547190 missense probably damaging 1.00
R4664:Mab21l2 UTSW 3 86547504 missense probably benign
R5245:Mab21l2 UTSW 3 86547492 missense possibly damaging 0.52
R5878:Mab21l2 UTSW 3 86546718 missense probably damaging 1.00
R6187:Mab21l2 UTSW 3 86547258 missense probably damaging 1.00
R6880:Mab21l2 UTSW 3 86547156 missense possibly damaging 0.71
R7021:Mab21l2 UTSW 3 86547486 missense probably benign 0.01
R8085:Mab21l2 UTSW 3 86548086 unclassified probably benign
R8095:Mab21l2 UTSW 3 86547462 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAGAGCATGCCCATTTATGTTGC -3'
(R):5'- TGATGGGCGGCTGTAGAAAC -3'

Sequencing Primer
(F):5'- GTTGCTTTCCACGCAGTCGG -3'
(R):5'- CTGTAGAAACAAGTGCCTCTCGG -3'
Posted On2016-12-15