Incidental Mutation 'R5791:Gstm2'
ID501516
Institutional Source Beutler Lab
Gene Symbol Gstm2
Ensembl Gene ENSMUSG00000040562
Gene Nameglutathione S-transferase, mu 2
SynonymsGstb2, Gstb-2
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107981702-107986453 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 107984128 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012348] [ENSMUST00000012348] [ENSMUST00000066530]
Predicted Effect probably null
Transcript: ENSMUST00000012348
SMART Domains Protein: ENSMUSP00000012348
Gene: ENSMUSG00000040562

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2.9e-24 PFAM
Pfam:GST_C_3 41 190 1.2e-10 PFAM
Pfam:GST_C 104 191 5.7e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000012348
SMART Domains Protein: ENSMUSP00000012348
Gene: ENSMUSG00000040562

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2.9e-24 PFAM
Pfam:GST_C_3 41 190 1.2e-10 PFAM
Pfam:GST_C 104 191 5.7e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000066530
SMART Domains Protein: ENSMUSP00000066675
Gene: ENSMUSG00000040562

DomainStartEndE-ValueType
Pfam:GST_N 1 48 6.8e-12 PFAM
Pfam:GST_C 70 158 8.4e-20 PFAM
Pfam:GST_C_3 84 156 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150808
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Gstm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Gstm2 APN 3 107985243 splice site probably null
IGL01821:Gstm2 APN 3 107985053 missense possibly damaging 0.51
IGL02662:Gstm2 APN 3 107985062 missense possibly damaging 0.94
IGL02667:Gstm2 APN 3 107986108 missense probably damaging 1.00
IGL03088:Gstm2 APN 3 107986046 missense probably benign 0.00
IGL03341:Gstm2 APN 3 107984205 missense possibly damaging 0.86
R0415:Gstm2 UTSW 3 107984006 missense probably benign 0.37
R1239:Gstm2 UTSW 3 107984028 missense possibly damaging 0.61
R2213:Gstm2 UTSW 3 107986093 missense probably damaging 1.00
R2437:Gstm2 UTSW 3 107984053 splice site probably benign
R3765:Gstm2 UTSW 3 107984030 missense probably damaging 1.00
R4402:Gstm2 UTSW 3 107986054 missense probably benign 0.02
R4805:Gstm2 UTSW 3 107985095 missense possibly damaging 0.92
R6918:Gstm2 UTSW 3 107985241 splice site probably null
R7669:Gstm2 UTSW 3 107985676 missense probably benign 0.00
R8224:Gstm2 UTSW 3 107983998 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCGACCCATGAAGTCCTTC -3'
(R):5'- CCCTGACTGAATCTCATGTAGGTG -3'

Sequencing Primer
(F):5'- CTTCAGGTTTGGGAAGGCATC -3'
(R):5'- GACTGAATCTCATGTAGGTGACTTC -3'
Posted On2017-12-01