Incidental Mutation 'R5800:Kdm1a'
ID447339
Institutional Source Beutler Lab
Gene Symbol Kdm1a
Ensembl Gene ENSMUSG00000036940
Gene Namelysine (K)-specific demethylase 1A
SynonymsAof2, 1810043O07Rik, Kdm1, LSD1
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location136550540-136602723 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 136573070 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000105847] [ENSMUST00000116273]
Predicted Effect probably null
Transcript: ENSMUST00000046846
SMART Domains Protein: ENSMUSP00000035457
Gene: ENSMUSG00000036940

DomainStartEndE-ValueType
low complexity region 47 80 N/A INTRINSIC
Pfam:SWIRM 85 173 1.1e-20 PFAM
Pfam:AlaDh_PNT_C 181 297 8.4e-8 PFAM
Pfam:FAD_binding_2 189 236 1.6e-6 PFAM
Pfam:Pyr_redox 189 237 6.5e-7 PFAM
Pfam:DAO 189 457 1.5e-9 PFAM
Pfam:NAD_binding_8 192 256 9e-16 PFAM
Pfam:Amino_oxidase 197 657 7e-133 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105847
SMART Domains Protein: ENSMUSP00000101473
Gene: ENSMUSG00000036940

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
low complexity region 76 97 N/A INTRINSIC
low complexity region 139 172 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
Pfam:SWIRM 197 285 8.8e-21 PFAM
Pfam:FAD_binding_2 301 348 6e-6 PFAM
Pfam:Pyr_redox 301 349 3e-6 PFAM
Pfam:DAO 301 557 9.9e-9 PFAM
Pfam:NAD_binding_8 304 368 4e-15 PFAM
Pfam:Amino_oxidase 309 847 2e-133 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116273
SMART Domains Protein: ENSMUSP00000111977
Gene: ENSMUSG00000036940

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
low complexity region 76 97 N/A INTRINSIC
low complexity region 139 172 N/A INTRINSIC
Pfam:SWIRM 175 265 2.7e-21 PFAM
Pfam:Pyr_redox 281 327 5.5e-7 PFAM
Pfam:FAD_binding_2 281 328 5.3e-6 PFAM
Pfam:DAO 281 403 3.7e-8 PFAM
Pfam:NAD_binding_8 284 348 5.7e-16 PFAM
Pfam:Amino_oxidase 289 827 9.6e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155354
SMART Domains Protein: ENSMUSP00000114268
Gene: ENSMUSG00000036940

DomainStartEndE-ValueType
Pfam:Amino_oxidase 3 250 2.9e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170979
SMART Domains Protein: ENSMUSP00000131385
Gene: ENSMUSG00000036940

DomainStartEndE-ValueType
Pfam:SWIRM 1 77 2.5e-18 PFAM
Pfam:Pyr_redox_2 70 142 1.1e-7 PFAM
Pfam:AlaDh_PNT_C 85 195 7.8e-8 PFAM
Pfam:FAD_binding_2 93 140 1.7e-6 PFAM
Pfam:Pyr_redox 93 142 8.2e-7 PFAM
Pfam:DAO 93 319 2.8e-9 PFAM
Pfam:NAD_binding_8 96 160 9.8e-16 PFAM
Pfam:Amino_oxidase 101 313 5.1e-32 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein containing a SWIRM domain, a FAD-binding motif, and an amine oxidase domain. This protein is a component of several histone deacetylase complexes, though it silences genes by functioning as a histone demethylase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous disruption of this gene results in abnormal gastrulation and early embryonic lethality. Homozygotes lacking the neurospecific isoform are hypoexcitable and display decreased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Kdm1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Kdm1a APN 4 136554247 missense probably damaging 1.00
IGL01106:Kdm1a APN 4 136572328 splice site probably benign
IGL01356:Kdm1a APN 4 136553891 missense probably damaging 1.00
IGL01886:Kdm1a APN 4 136561016 critical splice donor site probably null
IGL02605:Kdm1a APN 4 136551037 unclassified probably benign
IGL02885:Kdm1a APN 4 136552535 missense probably benign 0.00
Seven_falls UTSW 4 136568600 nonsense probably null
R0095:Kdm1a UTSW 4 136550894 missense probably benign 0.09
R0532:Kdm1a UTSW 4 136561066 missense probably damaging 1.00
R0553:Kdm1a UTSW 4 136555298 missense probably damaging 1.00
R3625:Kdm1a UTSW 4 136561108 missense possibly damaging 0.93
R4085:Kdm1a UTSW 4 136551962 nonsense probably null
R4285:Kdm1a UTSW 4 136582036 splice site probably null
R5118:Kdm1a UTSW 4 136557358 unclassified probably benign
R5493:Kdm1a UTSW 4 136557421 frame shift probably null
R5945:Kdm1a UTSW 4 136568701 splice site probably null
R6256:Kdm1a UTSW 4 136568600 nonsense probably null
R6508:Kdm1a UTSW 4 136554310 missense probably damaging 1.00
R7243:Kdm1a UTSW 4 136551954 missense probably damaging 1.00
R7270:Kdm1a UTSW 4 136552527 missense probably damaging 0.97
R7723:Kdm1a UTSW 4 136557749 missense probably benign 0.06
R8391:Kdm1a UTSW 4 136553843 missense probably benign 0.45
X0066:Kdm1a UTSW 4 136559225 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTCCTAAAACCTTCTCAAACAGG -3'
(R):5'- TGTGTGTATGAAGGCTTCACAC -3'

Sequencing Primer
(F):5'- CCTTCTCAAACAGGAAATTCGAAG -3'
(R):5'- TGTGTATGAAGGCTTCACACTAGAG -3'
Posted On2016-12-15