Incidental Mutation 'R5732:Naaa'
ID451479
Institutional Source Beutler Lab
Gene Symbol Naaa
Ensembl Gene ENSMUSG00000029413
Gene NameN-acylethanolamine acid amidase
Synonyms3830414F09Rik, Asahl, 2210023K21Rik
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location92257659-92278170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92263455 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 291 (T291I)
Ref Sequence ENSEMBL: ENSMUSP00000108726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113102] [ENSMUST00000159345] [ENSMUST00000175656]
Predicted Effect probably damaging
Transcript: ENSMUST00000113102
AA Change: T291I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108726
Gene: ENSMUSG00000029413
AA Change: T291I

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 127 7.3e-26 PFAM
Pfam:CBAH 131 362 9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159345
AA Change: T289I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124582
Gene: ENSMUSG00000029413
AA Change: T289I

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 125 1.3e-23 PFAM
Pfam:CBAH 129 360 1.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159732
Predicted Effect probably damaging
Transcript: ENSMUST00000175656
AA Change: T155I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acylethanolamine-hydrolyzing enzyme which is highly similar to acid ceramidase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Naaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Naaa APN 5 92265133 missense probably benign 0.32
IGL01470:Naaa APN 5 92263648 missense probably damaging 1.00
IGL01990:Naaa APN 5 92268063 missense possibly damaging 0.75
IGL02222:Naaa APN 5 92259550 unclassified probably benign
R0254:Naaa UTSW 5 92265135 missense probably damaging 1.00
R1658:Naaa UTSW 5 92272441 splice site probably null
R1930:Naaa UTSW 5 92278035 missense probably benign
R1931:Naaa UTSW 5 92278035 missense probably benign
R3788:Naaa UTSW 5 92272554 splice site probably null
R4182:Naaa UTSW 5 92272554 splice site probably null
R4373:Naaa UTSW 5 92278143 utr 5 prime probably benign
R4547:Naaa UTSW 5 92263586 splice site probably null
R5198:Naaa UTSW 5 92268045 nonsense probably null
R6009:Naaa UTSW 5 92259581 missense probably benign
R7037:Naaa UTSW 5 92277075 missense possibly damaging 0.46
R7540:Naaa UTSW 5 92263724 missense probably benign 0.15
R8280:Naaa UTSW 5 92263449 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGACCATGAGAAACATTGGAAGTC -3'
(R):5'- AGACATTTGGCCTCTTGACC -3'

Sequencing Primer
(F):5'- ATCATGCCTCTGATCCTTGGAGG -3'
(R):5'- CTCTTGACCCTCTGAATGGAGAG -3'
Posted On2017-01-03