Mutagenetix > Incidental Mutation

Incidental Mutation 'R5856:Sema5b'

454930

Institutional Source

Beutler Lab

Gene Symbol

Sema5b

Ensembl Gene

ENSMUSG00000052133

Gene Name

sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B

Synonyms

SemG, Semag, SemG

MMRRC Submission

043230-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5856 (G1)

Quality Score

163

Status

Not validated

Chromosome

Chromosomal Location

35541145-35664732 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to G at 35646386 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 219 (Y219*)

Ref Sequence

ENSEMBL: ENSMUSP00000112536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050625] [ENSMUST00000120756]

AlphaFold

Q60519

Predicted Effect

probably null
Transcript: ENSMUST00000050625
AA Change: Y219*

SMART Domains

Protein: ENSMUSP00000057494
Gene: ENSMUSG00000052133
AA Change: Y219*

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Sema	68	479	1.68e-174	SMART
PSI	497	544	9.18e-12	SMART
TSP1	609	662	3.34e-15	SMART
TSP1	667	713	3.42e-12	SMART
TSP1	798	850	1.58e-16	SMART
TSP1	855	907	2.45e-13	SMART
TSP1	910	957	1.02e-1	SMART
transmembrane domain	977	999	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120756
AA Change: Y219*

SMART Domains

Protein: ENSMUSP00000112536
Gene: ENSMUSG00000052133
AA Change: Y219*

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Sema	68	479	1.68e-174	SMART
PSI	497	544	9.18e-12	SMART
TSP1	609	662	3.34e-15	SMART
TSP1	667	742	7.61e-10	SMART
TSP1	827	879	1.58e-16	SMART
TSP1	884	936	2.45e-13	SMART
TSP1	939	986	1.02e-1	SMART
transmembrane domain	1006	1028	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133554

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display defects in neurite arborization of multiple retinal cell types. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Adgrf5	A	G	17: 43,446,120	T497A	probably benign	Het
Ano5	T	C	7: 51,585,326	I669T	probably benign	Het
Arhgap11a	A	T	2: 113,833,771	N722K	possibly damaging	Het
Atm	A	T	9: 53,495,955	I1161K	possibly damaging	Het
Atp13a4	T	C	16: 29,433,987	T714A	possibly damaging	Het
BC051665	T	A	13: 60,784,500	M92L	probably benign	Het
Car3	G	A	3: 14,871,641	V255M	probably damaging	Het
Cnot11	C	A	1: 39,537,453	F179L	probably benign	Het
Dctn1	A	G	6: 83,197,865	Y1013C	probably damaging	Het
Gm19965	A	G	1: 116,821,849	D420G	probably benign	Het
Gm5444	A	G	13: 4,771,684		noncoding transcript	Het
Hydin	A	T	8: 110,541,842	D2946V	probably damaging	Het
Hyou1	C	T	9: 44,381,344	R119C	probably damaging	Het
Ighm	A	T	12: 113,421,602	L246Q	unknown	Het
Itpr3	A	G	17: 27,106,405	E1324G	probably damaging	Het
Loxl4	G	T	19: 42,595,366	Q749K	possibly damaging	Het
Muc2	C	A	7: 141,745,644		probably benign	Het
Myh11	T	C	16: 14,205,976	T1505A	probably benign	Het
Nsmce2	A	G	15: 59,378,943	E21G	probably damaging	Het
Olfr1220	T	A	2: 89,097,910	I6F	probably benign	Het
Olfr273	T	A	4: 52,856,516		probably benign	Het
Plaa	A	G	4: 94,583,487	I375T	probably benign	Het
Pou2f1	C	T	1: 165,915,130	A65T	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rxfp1	T	A	3: 79,663,313	N271Y	possibly damaging	Het
Slc35f3	G	T	8: 126,321,080	R53L	probably benign	Het
Slc44a5	T	C	3: 154,258,392	V465A	possibly damaging	Het
Slc9a5	A	G	8: 105,357,165	I446V	possibly damaging	Het
Slf1	A	T	13: 77,106,087	D204E	possibly damaging	Het
Sox5	T	A	6: 144,209,362	T3S	probably damaging	Het
Srr	G	A	11: 74,913,012	R40C	possibly damaging	Het
Tas2r115	T	A	6: 132,737,538	H150L	possibly damaging	Het
Tet2	A	G	3: 133,486,640	S678P	probably benign	Het
Tmem11	T	C	11: 60,864,858	K183E	probably damaging	Het
Upf1	T	C	8: 70,334,762		probably null	Het
Xpo6	A	T	7: 126,149,502		probably benign	Het
Zfp638	C	T	6: 83,977,065	S1384L	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Sema5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00901:Sema5b	APN	16	35651315	missense	probably damaging	1.00
IGL01584:Sema5b	APN	16	35645423	missense	probably damaging	1.00
IGL01859:Sema5b	APN	16	35647109	missense	possibly damaging	0.94
IGL02195:Sema5b	APN	16	35660479	critical splice acceptor site	probably null
IGL02346:Sema5b	APN	16	35649755	missense	probably damaging	1.00
IGL02850:Sema5b	APN	16	35660515	missense	probably benign	0.01
IGL03277:Sema5b	APN	16	35651312	missense	probably damaging	0.96
R0101:Sema5b	UTSW	16	35663102	splice site	probably benign
R0368:Sema5b	UTSW	16	35628100	missense	probably damaging	1.00
R0426:Sema5b	UTSW	16	35646355	missense	probably damaging	1.00
R0675:Sema5b	UTSW	16	35660333	missense	probably benign	0.00
R0905:Sema5b	UTSW	16	35622631	missense	probably benign	0.33
R1163:Sema5b	UTSW	16	35628096	missense	probably benign	0.19
R1195:Sema5b	UTSW	16	35651660	missense	probably null	0.94
R1195:Sema5b	UTSW	16	35651660	missense	probably null	0.94
R1666:Sema5b	UTSW	16	35658482	missense	probably benign	0.03
R1706:Sema5b	UTSW	16	35649755	missense	probably damaging	0.98
R1733:Sema5b	UTSW	16	35646367	missense	probably damaging	1.00
R1775:Sema5b	UTSW	16	35660324	missense	probably benign
R2215:Sema5b	UTSW	16	35660215	missense	probably damaging	1.00
R2844:Sema5b	UTSW	16	35659931	missense	probably damaging	0.98
R3086:Sema5b	UTSW	16	35622723	missense	probably benign
R3613:Sema5b	UTSW	16	35660150	missense	probably benign
R4774:Sema5b	UTSW	16	35663182	missense	probably damaging	1.00
R5743:Sema5b	UTSW	16	35658476	missense	probably damaging	1.00
R5993:Sema5b	UTSW	16	35646202	missense	probably damaging	1.00
R6248:Sema5b	UTSW	16	35628007	splice site	probably null
R6420:Sema5b	UTSW	16	35663146	missense	probably benign	0.08
R6795:Sema5b	UTSW	16	35658571	nonsense	probably null
R6825:Sema5b	UTSW	16	35628007	splice site	probably null
R7066:Sema5b	UTSW	16	35651312	missense	probably benign	0.26
R7244:Sema5b	UTSW	16	35660545	missense	probably benign
R7446:Sema5b	UTSW	16	35647203	missense	probably damaging	1.00
R7497:Sema5b	UTSW	16	35661330	missense	probably damaging	1.00
R7516:Sema5b	UTSW	16	35651170	missense	probably benign	0.05
R7878:Sema5b	UTSW	16	35661626	missense	probably benign	0.00
R7922:Sema5b	UTSW	16	35658256	frame shift	probably null
R8397:Sema5b	UTSW	16	35651321	missense	possibly damaging	0.59
R8537:Sema5b	UTSW	16	35651609	missense	possibly damaging	0.49
R8929:Sema5b	UTSW	16	35647367	intron	probably benign
R9262:Sema5b	UTSW	16	35632853	missense	possibly damaging	0.57
R9389:Sema5b	UTSW	16	35645722	missense	probably damaging	1.00
R9579:Sema5b	UTSW	16	35647212	missense	probably benign	0.01
R9623:Sema5b	UTSW	16	35622751	missense	possibly damaging	0.74
Z1088:Sema5b	UTSW	16	35660590	missense	probably damaging	0.99
Z1176:Sema5b	UTSW	16	35628018	missense	probably benign	0.01
Z1176:Sema5b	UTSW	16	35646273	missense	probably benign	0.05
Z1176:Sema5b	UTSW	16	35649864	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGGGAAAGCTCTCTTCTCC -3'
(R):5'- CTAAGGACATCTGGGCCTCAAC -3'

Sequencing Primer
(F):5'- CTCAGCCGGACTATTGAGAAGATC -3'
(R):5'- ATCTGGGCCTCAACTCCAGTG -3'

Posted On

2017-02-10