Mutagenetix > Incidental Mutation

Incidental Mutation 'R0555:Hoga1'

45522

Institutional Source

Beutler Lab

Gene Symbol

Hoga1

Ensembl Gene

ENSMUSG00000025176

Gene Name

4-hydroxy-2-oxoglutarate aldolase 1

Synonyms

0610010D20Rik, Dhdpsl, Npl2

MMRRC Submission

038747-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R0555 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42045610-42070953 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 42046075 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 53 (E53A)

Ref Sequence

ENSEMBL: ENSMUSP00000126037 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026172] [ENSMUST00000081714] [ENSMUST00000172244]

AlphaFold

Q9DCU9

Predicted Effect

probably benign
Transcript: ENSMUST00000026172

SMART Domains

Protein: ENSMUSP00000026172
Gene: ENSMUSG00000025172

Domain	Start	End	E-Value	Type
low complexity region	104	111	N/A	INTRINSIC
ANK	149	178	5.24e-4	SMART
ANK	182	211	5.79e-6	SMART
ANK	215	244	1.33e-5	SMART
ANK	248	277	3.18e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000081714
AA Change: E53A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000080414
Gene: ENSMUSG00000025176
AA Change: E53A

Domain	Start	End	E-Value	Type
DHDPS	28	319	8.34e-81	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167381

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168414

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172244
AA Change: E53A

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126037
Gene: ENSMUSG00000025176
AA Change: E53A

Domain	Start	End	E-Value	Type
Pfam:DHDPS	57	156	5.8e-11	PFAM

Meta Mutation Damage Score

0.0978

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 93.8%

Validation Efficiency

100% (98/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The authors of PMID:20797690 cloned this gene while searching for genes in a region of chromosome 10 linked to primary hyperoxalurea type III. They noted that even though the encoded protein has been described as a mitochondrial dihydrodipicolinate synthase-like enzyme, it shares little homology with E. coli dihydrodipicolinate synthase (Dhdps), particularly in the putative substrate-binding region. Moreover, neither lysine biosynthesis nor sialic acid metabolism, for which Dhdps is responsible, occurs in vertebrate mitochondria. They propose that this gene encodes mitochondrial 4-hydroxyl-2-oxoglutarate aldolase (EC 4.1.3.16), which catalyzes the final step in the metabolic pathway of hydroxyproline, releasing glyoxylate and pyruvate. This gene is predominantly expressed in the liver and kidney, and mutations in this gene are found in patients with primary hyperoxalurea type III. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal urinary excretion of oxalate but show increased urine 2,4-dihydroxyglutarate (DHG) levels especially when challenged by the inclusion of hydroxyproline in the diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam10	T	A	9: 70,754,234	I363N	probably damaging	Het
Ahcyl2	T	C	6: 29,890,671		probably benign	Het
Asap1	A	G	15: 64,094,364	L941P	probably damaging	Het
Aurka	G	A	2: 172,367,147	R23C	probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Casp8ap2	T	A	4: 32,640,381	H478Q	probably damaging	Het
Clcn4	C	T	7: 7,290,504	A418T	possibly damaging	Het
Cpxm2	A	T	7: 132,044,043	Y715*	probably null	Het
Csmd1	T	C	8: 16,185,273	M1179V	probably benign	Het
Ddx21	A	T	10: 62,587,528	F632I	probably damaging	Het
Dnaic1	C	A	4: 41,625,335	T433K	possibly damaging	Het
Dpyd	G	A	3: 119,431,542	G988D	probably damaging	Het
Dync1i2	AAAAGAAGAGGAAAGAAGAGGAAAG	AAAAGAAGAGGAAAG	2: 71,214,518		probably null	Het
Dync1li2	A	T	8: 104,420,665	S466T	probably benign	Het
Ears2	T	C	7: 122,048,444	T206A	probably benign	Het
Elmod1	A	T	9: 53,931,592		probably benign	Het
Eps8l3	C	A	3: 107,892,345	D590E	probably benign	Het
Etfdh	A	T	3: 79,605,805	H370Q	probably benign	Het
Fam83g	C	A	11: 61,707,663	A792E	probably benign	Het
Ffar3	G	T	7: 30,855,537	Y119*	probably null	Het
Fosb	G	T	7: 19,307,213	S118R	possibly damaging	Het
Foxn4	G	A	5: 114,263,114	L3F	probably damaging	Het
Foxo4	A	G	X: 101,255,178	K65E	probably damaging	Het
Frem2	A	G	3: 53,516,860	L3052P	probably damaging	Het
Fubp3	G	A	2: 31,608,137	R101H	probably damaging	Het
Gba2	C	A	4: 43,569,927	G429C	probably damaging	Het
Gimap1	T	C	6: 48,741,429		probably benign	Het
Gm17657	A	T	17: 29,519,571	F74I	probably benign	Het
Gnas	A	G	2: 174,298,511	T158A	possibly damaging	Het
Gpc5	T	C	14: 115,552,328	V538A	probably damaging	Het
Greb1l	T	C	18: 10,458,781		probably benign	Het
H2-M10.5	G	A	17: 36,774,728	G260R	probably damaging	Het
Hbs1l	A	C	10: 21,349,323	Q412H	probably benign	Het
Hecw1	G	T	13: 14,236,941	T1058N	probably damaging	Het
Heph	A	T	X: 96,558,084	T1027S	probably damaging	Het
Insrr	T	G	3: 87,814,437		probably benign	Het
Ipo11	A	T	13: 106,892,461	V328D	probably damaging	Het
Jakmip1	T	C	5: 37,118,873	V509A	probably damaging	Het
Jmjd1c	T	C	10: 67,225,789	V1307A	probably benign	Het
Kmt2a	T	A	9: 44,847,571	S1027C	probably damaging	Het
Kprp	G	C	3: 92,824,357	P462R	unknown	Het
Lman1l	T	C	9: 57,614,101	T193A	probably benign	Het
Lrit3	A	T	3: 129,791,296	V271D	probably damaging	Het
Map4	T	A	9: 109,979,103		probably benign	Het
Mark4	A	C	7: 19,448,673		probably benign	Het
Mfsd14b	A	G	13: 65,078,445	V142A	probably benign	Het
Mis18bp1	A	T	12: 65,161,453	I162N	possibly damaging	Het
Mrpl43	A	T	19: 45,005,952		probably benign	Het
Mrpl47	A	G	3: 32,736,693	F16S	probably benign	Het
Myh2	G	T	11: 67,178,967	G380C	probably damaging	Het
Myo15	T	C	11: 60,521,638	Y3284H	probably damaging	Het
Nectin2	A	G	7: 19,733,223		probably benign	Het
Neu3	A	G	7: 99,814,183	V111A	probably damaging	Het
Nol4l	T	C	2: 153,417,684		probably null	Het
Nphp3	C	A	9: 104,023,434	H510Q	probably damaging	Het
Nprl3	T	A	11: 32,233,118		probably null	Het
Olfr292	A	G	7: 86,695,308	N284S	probably damaging	Het
Olfr48	T	C	2: 89,844,443	T177A	probably benign	Het
Olfr598	T	C	7: 103,328,963	V159A	probably benign	Het
Olfr791	T	C	10: 129,526,896	I223T	possibly damaging	Het
Pex1	A	G	5: 3,606,130	E319G	possibly damaging	Het
Phtf1	C	A	3: 104,004,469	T709K	probably damaging	Het
Plek2	A	T	12: 78,892,172	L271Q	probably damaging	Het
Plekhg5	T	A	4: 152,107,469	C421*	probably null	Het
Polk	A	C	13: 96,484,179	C525W	probably damaging	Het
Ppfibp2	T	C	7: 107,729,174	S471P	probably damaging	Het
Prickle2	A	T	6: 92,458,565	F74L	probably benign	Het
Prl7d1	A	T	13: 27,712,055	V113D	probably benign	Het
Prr14	C	T	7: 127,472,095		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ret	A	G	6: 118,178,610	V375A	probably damaging	Het
Rora	T	C	9: 69,361,746	F41S	probably damaging	Het
Sall1	T	C	8: 89,031,758	T573A	probably benign	Het
Shb	A	G	4: 45,458,321	V281A	possibly damaging	Het
Slc25a26	A	T	6: 94,592,410		probably null	Het
Sltm	T	C	9: 70,586,081	F769L	probably damaging	Het
Snx9	T	A	17: 5,918,413	M328K	probably damaging	Het
Stk25	G	T	1: 93,624,591	Q356K	probably benign	Het
Svep1	T	A	4: 58,128,858	Y613F	possibly damaging	Het
Syne4	G	A	7: 30,316,744	A195T	probably damaging	Het
Tmem8	T	C	17: 26,117,114	L130S	probably benign	Het
Trcg1	C	T	9: 57,242,333	T396M	probably damaging	Het
Trim30b	A	G	7: 104,357,298	V117A	possibly damaging	Het
Trpc4	T	C	3: 54,302,090		probably benign	Het
Ttll4	A	G	1: 74,688,280	H827R	probably damaging	Het
Urgcp	T	C	11: 5,717,477	E287G	probably damaging	Het
Usp2	G	T	9: 44,092,784	L319F	probably damaging	Het
Vmn1r167	A	T	7: 23,505,087	V168D	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r61	A	T	7: 42,266,018	I130F	probably benign	Het
Vmn2r63	A	T	7: 42,928,528	Y195*	probably null	Het
Vmn2r81	T	C	10: 79,293,449	S725P	probably damaging	Het
Wnt10b	A	G	15: 98,772,937		probably benign	Het
Zcchc6	A	G	13: 59,800,317	V328A	probably benign	Het
Zfp292	T	C	4: 34,807,194	E1950G	probably damaging	Het
Zfyve16	A	G	13: 92,516,520		probably benign	Het

Other mutations in Hoga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eroica	UTSW	19	42060246	nonsense	probably null
R1225:Hoga1	UTSW	19	42070189	missense	probably damaging	1.00
R1991:Hoga1	UTSW	19	42060020	splice site	probably null
R2103:Hoga1	UTSW	19	42060020	splice site	probably null
R2184:Hoga1	UTSW	19	42061391	missense	probably damaging	1.00
R5643:Hoga1	UTSW	19	42059963	missense	probably benign	0.00
R7060:Hoga1	UTSW	19	42060246	nonsense	probably null
R8756:Hoga1	UTSW	19	42060277	missense	probably benign	0.00
R8772:Hoga1	UTSW	19	42045945	missense	probably benign
R9101:Hoga1	UTSW	19	42059908	missense	possibly damaging	0.88
R9254:Hoga1	UTSW	19	42063258	missense	probably damaging	1.00
R9379:Hoga1	UTSW	19	42063258	missense	probably damaging	1.00
R9420:Hoga1	UTSW	19	42059894	missense

Predicted Primers

PCR Primer
(F):5'- AGGAAGGAGTCCAAACTCAGTTCCC -3'
(R):5'- TAGGATGTAGTCCGTGGCCTCAAG -3'

Sequencing Primer
(F):5'- AAACTCAGTTCCCCTGTGGTC -3'
(R):5'- cattcactgccccatgttttc -3'

Posted On

2013-06-11