Incidental Mutation 'R5896:Map4'
ID457526
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Namemicrotubule-associated protein 4
SynonymsMtap4, MAP 4
MMRRC Submission 044095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5896 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109931460-110083955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110072634 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 781 (V781M)
Ref Sequence ENSEMBL: ENSMUSP00000131285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000163979] [ENSMUST00000164930] [ENSMUST00000165876] [ENSMUST00000198511] [ENSMUST00000199161] [ENSMUST00000199461] [ENSMUST00000199498] [ENSMUST00000199548]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035055
AA Change: V972M

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479
AA Change: V972M

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000163979
AA Change: V261M

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129362
Gene: ENSMUSG00000032479
AA Change: V261M

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164930
AA Change: V781M

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131285
Gene: ENSMUSG00000032479
AA Change: V781M

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 6e-16 PFAM
Pfam:Tubulin-binding 774 804 4.5e-19 PFAM
Pfam:Tubulin-binding 805 835 2.3e-18 PFAM
Pfam:Tubulin-binding 836 867 1.6e-11 PFAM
low complexity region 902 917 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165876
AA Change: V972M

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479
AA Change: V972M

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198185
Predicted Effect probably benign
Transcript: ENSMUST00000198511
AA Change: V62M

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142558
Gene: ENSMUSG00000032479
AA Change: V62M

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Tubulin-binding 24 54 7.3e-14 PFAM
Pfam:Tubulin-binding 55 85 5.3e-17 PFAM
Pfam:Tubulin-binding 86 116 2.8e-16 PFAM
Pfam:Tubulin-binding 117 148 1.9e-9 PFAM
low complexity region 183 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199161
AA Change: V54M

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143205
Gene: ENSMUSG00000032479
AA Change: V54M

DomainStartEndE-ValueType
Pfam:Tubulin-binding 16 46 6.7e-14 PFAM
Pfam:Tubulin-binding 47 77 4.9e-17 PFAM
Pfam:Tubulin-binding 78 108 2.5e-16 PFAM
Pfam:Tubulin-binding 109 140 1.7e-9 PFAM
low complexity region 176 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199461
SMART Domains Protein: ENSMUSP00000143296
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1e-13 PFAM
Pfam:Tubulin-binding 147 177 3.8e-16 PFAM
Pfam:Tubulin-binding 178 209 2.6e-9 PFAM
low complexity region 244 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199498
SMART Domains Protein: ENSMUSP00000142439
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199548
AA Change: V154M

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143408
Gene: ENSMUSG00000032479
AA Change: V154M

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1.1e-13 PFAM
Pfam:Tubulin-binding 147 177 7.9e-17 PFAM
Pfam:Tubulin-binding 178 208 4.1e-16 PFAM
Pfam:Tubulin-binding 209 240 2.8e-9 PFAM
Meta Mutation Damage Score 0.1094 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,707,433 S159T probably damaging Het
2610028H24Rik T A 10: 76,452,830 M53K probably benign Het
3425401B19Rik G A 14: 32,661,675 Q778* probably null Het
Abhd16a T A 17: 35,091,725 probably benign Het
Acp6 A G 3: 97,168,494 K226R probably benign Het
Ankfy1 A G 11: 72,759,985 D998G probably damaging Het
Apbb1 G T 7: 105,574,225 P60T probably damaging Het
Apol9a T A 15: 77,404,505 I221F probably benign Het
Arhgap29 A G 3: 122,012,087 E947G possibly damaging Het
B430218F22Rik A T 13: 118,387,398 probably benign Het
BC003331 A T 1: 150,380,360 N211K probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,503,999 probably null Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccdc93 G T 1: 121,463,120 V274L possibly damaging Het
Cdc25a A G 9: 109,884,365 D191G probably benign Het
Cmya5 A G 13: 93,045,865 probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,443,271 probably benign Het
Csde1 T C 3: 103,040,543 probably benign Het
Ctdp1 A G 18: 80,458,788 L177P probably damaging Het
Dnah5 T A 15: 28,272,060 H1003Q probably benign Het
Epb41l2 T A 10: 25,493,596 N604K probably damaging Het
Fam166a A T 2: 25,220,566 M129L probably benign Het
Fig4 T A 10: 41,254,885 N465Y possibly damaging Het
Gemin7 G A 7: 19,565,298 S124F probably damaging Het
Gli3 G A 13: 15,726,180 R1384K probably benign Het
Gm11127 T A 17: 36,056,344 M329L probably benign Het
Gm12258 G A 11: 58,859,631 C544Y probably damaging Het
Grm1 C T 10: 11,080,550 probably benign Het
Hps4 C T 5: 112,369,485 T246I probably benign Het
Ifngr2 A T 16: 91,561,765 E284D possibly damaging Het
Impdh2 A G 9: 108,563,966 T148A probably benign Het
Irx3 T C 8: 91,801,135 S36G probably benign Het
Itga5 T A 15: 103,351,087 K667N probably benign Het
Itgad G A 7: 128,174,016 C15Y probably benign Het
Ly75 T G 2: 60,383,146 E29A probably benign Het
Magi1 T A 6: 93,708,199 S506C probably damaging Het
Med23 T C 10: 24,902,145 L797P probably damaging Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Ncor1 G T 11: 62,383,190 P55Q probably damaging Het
Ofcc1 T A 13: 40,180,584 I344F probably benign Het
Olfr1161 A G 2: 88,025,121 Y133C probably damaging Het
Olfr1247 C A 2: 89,609,323 V260F probably damaging Het
Olfr173 G A 16: 58,797,732 T38I probably damaging Het
Olfr984 A T 9: 40,100,893 M199K probably damaging Het
Otub2 C T 12: 103,403,428 probably benign Het
Parva A G 7: 112,544,753 M83V probably benign Het
Pcdha8 T A 18: 36,993,519 N351K probably benign Het
Pcdhb5 T A 18: 37,322,679 L704* probably null Het
Pkd1l3 T A 8: 109,626,836 L683H probably damaging Het
Plekhn1 C T 4: 156,223,874 R288H probably benign Het
Polr2a A T 11: 69,736,260 N1457K probably damaging Het
Ppp1r12b A G 1: 134,765,981 S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 K1062E probably damaging Het
Ptpre A T 7: 135,674,278 T498S probably benign Het
Pus7l C T 15: 94,529,451 probably null Het
Rptn C T 3: 93,398,332 Q991* probably null Het
Rsu1 T G 2: 13,224,359 E76A probably damaging Het
Sept11 T A 5: 93,156,965 F214I probably damaging Het
Slc1a7 G T 4: 108,012,390 A551S probably benign Het
Slc45a2 T A 15: 11,000,855 Y13* probably null Het
Slc7a14 T G 3: 31,257,570 L100F probably damaging Het
Slit3 A G 11: 35,708,105 E1512G probably damaging Het
Stat5a A G 11: 100,877,057 Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 T1811A possibly damaging Het
Tarbp1 A G 8: 126,452,928 F624L probably benign Het
Tfeb T G 17: 47,759,508 probably null Het
Tnxb G A 17: 34,672,152 G490R probably damaging Het
Tra2b T C 16: 22,259,203 Y32C probably damaging Het
Trpv4 C T 5: 114,622,647 probably benign Het
Uvrag A T 7: 98,988,207 L138* probably null Het
Vwf A T 6: 125,678,762 probably null Het
Wdr47 G A 3: 108,619,006 D282N probably damaging Het
Xirp2 A G 2: 67,508,698 M428V probably benign Het
Xirp2 A G 2: 67,509,946 N844D possibly damaging Het
Znfx1 G A 2: 167,039,000 T288I probably damaging Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 110072604 splice site probably benign
IGL01331:Map4 APN 9 110034801 missense probably benign 0.04
IGL01599:Map4 APN 9 110034768 missense probably benign 0.26
IGL01631:Map4 APN 9 110063133 unclassified probably benign
IGL02208:Map4 APN 9 109978870 start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109999833 missense probably benign 0.15
IGL02625:Map4 APN 9 110064417 missense probably damaging 1.00
PIT4486001:Map4 UTSW 9 110072614 missense probably damaging 1.00
R0149:Map4 UTSW 9 110067624 missense probably damaging 0.96
R0384:Map4 UTSW 9 110034628 missense probably damaging 0.99
R0392:Map4 UTSW 9 110078045 missense probably damaging 1.00
R0496:Map4 UTSW 9 110039850 intron probably benign
R0526:Map4 UTSW 9 110037278 splice site probably null
R0555:Map4 UTSW 9 109979103 splice site probably benign
R0571:Map4 UTSW 9 110036766 missense probably benign 0.00
R0698:Map4 UTSW 9 110068788 nonsense probably null
R0762:Map4 UTSW 9 110038478 intron probably benign
R0862:Map4 UTSW 9 109978969 missense probably damaging 1.00
R0864:Map4 UTSW 9 109978969 missense probably damaging 1.00
R1168:Map4 UTSW 9 110034964 missense probably benign 0.00
R1238:Map4 UTSW 9 110068580 missense probably benign 0.00
R1735:Map4 UTSW 9 110034955 missense probably benign 0.00
R1869:Map4 UTSW 9 110034964 missense probably benign 0.00
R1869:Map4 UTSW 9 110068928 missense possibly damaging 0.95
R2196:Map4 UTSW 9 110071048 missense probably damaging 1.00
R2264:Map4 UTSW 9 110081457 missense probably damaging 1.00
R2507:Map4 UTSW 9 110037483 intron probably benign
R2512:Map4 UTSW 9 110034702 missense possibly damaging 0.48
R3087:Map4 UTSW 9 110053189 missense possibly damaging 0.84
R3154:Map4 UTSW 9 109999792 missense probably benign 0.19
R3498:Map4 UTSW 9 110035212 missense probably benign 0.03
R3547:Map4 UTSW 9 110052198 missense possibly damaging 0.61
R3751:Map4 UTSW 9 110038674 intron probably benign
R4036:Map4 UTSW 9 110032215 missense possibly damaging 0.47
R4423:Map4 UTSW 9 110067594 missense probably damaging 1.00
R4505:Map4 UTSW 9 110032185 missense probably benign 0.01
R4561:Map4 UTSW 9 110052371 missense possibly damaging 0.91
R4577:Map4 UTSW 9 110081421 missense possibly damaging 0.48
R4601:Map4 UTSW 9 110052819 missense possibly damaging 0.75
R4795:Map4 UTSW 9 110035263 missense probably benign 0.00
R4801:Map4 UTSW 9 110035257 missense probably benign 0.15
R4802:Map4 UTSW 9 110035257 missense probably benign 0.15
R4999:Map4 UTSW 9 110038377 intron probably benign
R5020:Map4 UTSW 9 110068800 missense probably benign 0.02
R5021:Map4 UTSW 9 110038089 nonsense probably null
R5049:Map4 UTSW 9 110079814 nonsense probably null
R5451:Map4 UTSW 9 110037783 intron probably benign
R5452:Map4 UTSW 9 110037783 intron probably benign
R5453:Map4 UTSW 9 110037783 intron probably benign
R5492:Map4 UTSW 9 110052382 missense possibly damaging 0.68
R5532:Map4 UTSW 9 110034678 missense probably benign 0.24
R5602:Map4 UTSW 9 110052700 missense possibly damaging 0.84
R5628:Map4 UTSW 9 110081847 missense probably benign 0.04
R6017:Map4 UTSW 9 110034619 missense probably benign 0.00
R6084:Map4 UTSW 9 110064292 missense probably damaging 1.00
R6294:Map4 UTSW 9 110002746 missense possibly damaging 0.82
R6397:Map4 UTSW 9 110027716 missense possibly damaging 0.78
R6773:Map4 UTSW 9 110034925 missense probably benign 0.00
R6997:Map4 UTSW 9 110052914 missense probably benign 0.35
R7141:Map4 UTSW 9 109978870 start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 110053133 missense probably benign 0.03
R7320:Map4 UTSW 9 110081517 missense probably benign 0.24
R7469:Map4 UTSW 9 110027797 splice site probably null
R7479:Map4 UTSW 9 110068824 missense possibly damaging 0.94
R7487:Map4 UTSW 9 110027715 missense probably damaging 1.00
R7690:Map4 UTSW 9 109999793 missense probably damaging 0.99
R7780:Map4 UTSW 9 110034652 missense probably benign 0.00
R7998:Map4 UTSW 9 110079861 missense probably damaging 1.00
R8028:Map4 UTSW 9 110068744 missense probably damaging 1.00
R8557:Map4 UTSW 9 110064302 splice site probably null
R8950:Map4 UTSW 9 110072634 missense possibly damaging 0.91
Z1177:Map4 UTSW 9 110068523 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACATAGCTCTGTCCAGCCTG -3'
(R):5'- AGGGAAGGGATTCTGTGTCATC -3'

Sequencing Primer
(F):5'- AGCCTGCTTCTGTCTTGTG -3'
(R):5'- GAAGGGATTCTGTGTCATCTTCCC -3'
Posted On2017-02-15