Mutagenetix > Incidental Mutation

Incidental Mutation 'R5896:Gli3'

457542

Institutional Source

Beutler Lab

Gene Symbol

Gli3

Ensembl Gene

ENSMUSG00000021318

Gene Name

GLI-Kruppel family member GLI3

Synonyms

brachyphalangy, Bph

MMRRC Submission

044095-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5896 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15463235-15730026 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 15726180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 1384 (R1384K)

Ref Sequence

ENSEMBL: ENSMUSP00000106137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110510]

AlphaFold

Q61602

Predicted Effect

probably benign
Transcript: ENSMUST00000110510
AA Change: R1384K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: R1384K

Domain	Start	End	E-Value	Type
low complexity region	120	136	N/A	INTRINSIC
low complexity region	204	220	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	403	421	N/A	INTRINSIC
ZnF_C2H2	480	505	1.53e-1	SMART
ZnF_C2H2	513	540	1.23e0	SMART
ZnF_C2H2	546	570	3.16e-3	SMART
ZnF_C2H2	576	601	4.17e-3	SMART
ZnF_C2H2	607	632	1.4e-4	SMART
low complexity region	703	726	N/A	INTRINSIC
low complexity region	756	763	N/A	INTRINSIC
low complexity region	849	880	N/A	INTRINSIC
low complexity region	934	944	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1166	1175	N/A	INTRINSIC

Meta Mutation Damage Score

0.1067

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.5%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	A	T	16: 88,707,433	S159T	probably damaging	Het
2610028H24Rik	T	A	10: 76,452,830	M53K	probably benign	Het
3425401B19Rik	G	A	14: 32,661,675	Q778*	probably null	Het
Abhd16a	T	A	17: 35,091,725		probably benign	Het
Acp6	A	G	3: 97,168,494	K226R	probably benign	Het
Ankfy1	A	G	11: 72,759,985	D998G	probably damaging	Het
Apbb1	G	T	7: 105,574,225	P60T	probably damaging	Het
Apol9a	T	A	15: 77,404,505	I221F	probably benign	Het
Arhgap29	A	G	3: 122,012,087	E947G	possibly damaging	Het
B430218F22Rik	A	T	13: 118,387,398		probably benign	Het
BC003331	A	T	1: 150,380,360	N211K	probably benign	Het
Carmil3	ACCCCC	ACCCCCCC	14: 55,503,999		probably null	Het
Ccdc69	C	T	11: 55,052,890		probably null	Het
Ccdc93	G	T	1: 121,463,120	V274L	possibly damaging	Het
Cdc25a	A	G	9: 109,884,365	D191G	probably benign	Het
Cmya5	A	G	13: 93,045,865		probably null	Het
Crebzf	TGGAGGAGGAGGAGGAGGA	TGGAGGAGGAGGAGGA	7: 90,443,271		probably benign	Het
Csde1	T	C	3: 103,040,543		probably benign	Het
Ctdp1	A	G	18: 80,458,788	L177P	probably damaging	Het
Dnah5	T	A	15: 28,272,060	H1003Q	probably benign	Het
Epb41l2	T	A	10: 25,493,596	N604K	probably damaging	Het
Fam166a	A	T	2: 25,220,566	M129L	probably benign	Het
Fig4	T	A	10: 41,254,885	N465Y	possibly damaging	Het
Gemin7	G	A	7: 19,565,298	S124F	probably damaging	Het
Gm11127	T	A	17: 36,056,344	M329L	probably benign	Het
Gm12258	G	A	11: 58,859,631	C544Y	probably damaging	Het
Grm1	C	T	10: 11,080,550		probably benign	Het
Hps4	C	T	5: 112,369,485	T246I	probably benign	Het
Ifngr2	A	T	16: 91,561,765	E284D	possibly damaging	Het
Impdh2	A	G	9: 108,563,966	T148A	probably benign	Het
Irx3	T	C	8: 91,801,135	S36G	probably benign	Het
Itga5	T	A	15: 103,351,087	K667N	probably benign	Het
Itgad	G	A	7: 128,174,016	C15Y	probably benign	Het
Ly75	T	G	2: 60,383,146	E29A	probably benign	Het
Magi1	T	A	6: 93,708,199	S506C	probably damaging	Het
Map4	G	A	9: 110,072,634	V781M	possibly damaging	Het
Med23	T	C	10: 24,902,145	L797P	probably damaging	Het
Naip1	C	T	13: 100,423,128	G1123R	probably benign	Het
Ncor1	G	T	11: 62,383,190	P55Q	probably damaging	Het
Ofcc1	T	A	13: 40,180,584	I344F	probably benign	Het
Olfr1161	A	G	2: 88,025,121	Y133C	probably damaging	Het
Olfr1247	C	A	2: 89,609,323	V260F	probably damaging	Het
Olfr173	G	A	16: 58,797,732	T38I	probably damaging	Het
Olfr984	A	T	9: 40,100,893	M199K	probably damaging	Het
Otub2	C	T	12: 103,403,428		probably benign	Het
Parva	A	G	7: 112,544,753	M83V	probably benign	Het
Pcdha8	T	A	18: 36,993,519	N351K	probably benign	Het
Pcdhb5	T	A	18: 37,322,679	L704*	probably null	Het
Pkd1l3	T	A	8: 109,626,836	L683H	probably damaging	Het
Plekhn1	C	T	4: 156,223,874	R288H	probably benign	Het
Polr2a	A	T	11: 69,736,260	N1457K	probably damaging	Het
Ppp1r12b	A	G	1: 134,765,981	S981P	probably damaging	Het
Ppp1r9a	A	G	6: 5,159,648	K1062E	probably damaging	Het
Ptpre	A	T	7: 135,674,278	T498S	probably benign	Het
Pus7l	C	T	15: 94,529,451		probably null	Het
Rptn	C	T	3: 93,398,332	Q991*	probably null	Het
Rsu1	T	G	2: 13,224,359	E76A	probably damaging	Het
Sept11	T	A	5: 93,156,965	F214I	probably damaging	Het
Slc1a7	G	T	4: 108,012,390	A551S	probably benign	Het
Slc45a2	T	A	15: 11,000,855	Y13*	probably null	Het
Slc7a14	T	G	3: 31,257,570	L100F	probably damaging	Het
Slit3	A	G	11: 35,708,105	E1512G	probably damaging	Het
Stat5a	A	G	11: 100,877,057	Q458R	possibly damaging	Het
Svep1	T	C	4: 58,084,906	T1811A	possibly damaging	Het
Tarbp1	A	G	8: 126,452,928	F624L	probably benign	Het
Tfeb	T	G	17: 47,759,508		probably null	Het
Tnxb	G	A	17: 34,672,152	G490R	probably damaging	Het
Tra2b	T	C	16: 22,259,203	Y32C	probably damaging	Het
Trpv4	C	T	5: 114,622,647		probably benign	Het
Uvrag	A	T	7: 98,988,207	L138*	probably null	Het
Vwf	A	T	6: 125,678,762		probably null	Het
Wdr47	G	A	3: 108,619,006	D282N	probably damaging	Het
Xirp2	A	G	2: 67,508,698	M428V	probably benign	Het
Xirp2	A	G	2: 67,509,946	N844D	possibly damaging	Het
Znfx1	G	A	2: 167,039,000	T288I	probably damaging	Het

Other mutations in Gli3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Gli3	APN	13	15644299	missense	probably damaging	1.00
IGL00471:Gli3	APN	13	15723769	critical splice donor site	probably null
IGL00484:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL00588:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL01161:Gli3	APN	13	15548398	critical splice acceptor site	probably null
IGL01633:Gli3	APN	13	15648634	missense	probably damaging	1.00
IGL01799:Gli3	APN	13	15726161	missense	probably benign	0.00
IGL01861:Gli3	APN	13	15725325	missense	probably damaging	1.00
IGL02063:Gli3	APN	13	15726372	missense	possibly damaging	0.94
IGL02112:Gli3	APN	13	15662514	missense	probably damaging	1.00
IGL02255:Gli3	APN	13	15648719	missense	probably damaging	1.00
IGL02270:Gli3	APN	13	15726786	utr 3 prime	probably benign
IGL02336:Gli3	APN	13	15720289	missense	probably damaging	1.00
IGL02346:Gli3	APN	13	15723693	missense	probably damaging	1.00
IGL02744:Gli3	APN	13	15613886	critical splice donor site	probably null
IGL02877:Gli3	APN	13	15724742	missense	probably damaging	1.00
IGL02975:Gli3	APN	13	15724568	missense	probably damaging	1.00
IGL03018:Gli3	APN	13	15660132	missense	probably damaging	1.00
IGL03378:Gli3	APN	13	15644420	missense	probably damaging	1.00
IGL03406:Gli3	APN	13	15648581	missense	probably damaging	1.00
Capone	UTSW	13	15715034	missense	probably damaging	1.00
Carpals	UTSW	13	15713650	critical splice donor site	probably null
Ness	UTSW	13	15723555	missense	probably damaging	1.00
FR4737:Gli3	UTSW	13	15644357	missense	probably damaging	1.00
R0110:Gli3	UTSW	13	15724785	missense	probably damaging	1.00
R0329:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0330:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0360:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0364:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0469:Gli3	UTSW	13	15724785	missense	probably damaging	1.00
R0616:Gli3	UTSW	13	15662406	missense	possibly damaging	0.75
R0639:Gli3	UTSW	13	15724715	missense	probably damaging	1.00
R1072:Gli3	UTSW	13	15713605	missense	probably damaging	1.00
R1257:Gli3	UTSW	13	15725996	nonsense	probably null
R1270:Gli3	UTSW	13	15723744	missense	probably benign	0.02
R1424:Gli3	UTSW	13	15726314	missense	probably benign	0.00
R1481:Gli3	UTSW	13	15613850	missense	probably damaging	0.99
R1596:Gli3	UTSW	13	15725471	missense	possibly damaging	0.74
R1628:Gli3	UTSW	13	15726312	missense	probably benign	0.00
R1721:Gli3	UTSW	13	15726297	missense	probably benign	0.27
R1797:Gli3	UTSW	13	15713512	missense	probably damaging	0.99
R1813:Gli3	UTSW	13	15648691	missense	probably damaging	1.00
R1819:Gli3	UTSW	13	15725792	nonsense	probably null
R1988:Gli3	UTSW	13	15726380	missense	probably benign
R2132:Gli3	UTSW	13	15725549	missense	possibly damaging	0.74
R2352:Gli3	UTSW	13	15662392	missense	probably benign	0.02
R3085:Gli3	UTSW	13	15660941	missense	probably damaging	1.00
R3177:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R3277:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R4162:Gli3	UTSW	13	15725115	missense	possibly damaging	0.93
R4497:Gli3	UTSW	13	15723571	missense	possibly damaging	0.74
R4526:Gli3	UTSW	13	15713631	missense	probably damaging	1.00
R4979:Gli3	UTSW	13	15724464	missense	possibly damaging	0.87
R5327:Gli3	UTSW	13	15548507	missense	probably damaging	0.99
R5395:Gli3	UTSW	13	15714950	missense	probably damaging	1.00
R5494:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R5609:Gli3	UTSW	13	15548453	missense	possibly damaging	0.82
R5718:Gli3	UTSW	13	15478165	critical splice donor site	probably null
R5810:Gli3	UTSW	13	15644309	missense	probably damaging	0.99
R5930:Gli3	UTSW	13	15548625	missense	probably damaging	1.00
R5964:Gli3	UTSW	13	15726162	nonsense	probably null
R5985:Gli3	UTSW	13	15723555	missense	probably damaging	1.00
R6224:Gli3	UTSW	13	15725145	missense	probably benign
R6278:Gli3	UTSW	13	15725113	missense	possibly damaging	0.69
R6330:Gli3	UTSW	13	15724732	missense	probably damaging	1.00
R6383:Gli3	UTSW	13	15723555	missense	probably damaging	1.00
R6523:Gli3	UTSW	13	15713650	critical splice donor site	probably null
R7072:Gli3	UTSW	13	15725695	missense	possibly damaging	0.51
R7085:Gli3	UTSW	13	15715062	missense	probably damaging	1.00
R7228:Gli3	UTSW	13	15724502	missense	probably benign	0.00
R7327:Gli3	UTSW	13	15725559	missense	probably benign	0.02
R7451:Gli3	UTSW	13	15726291	missense	possibly damaging	0.50
R7974:Gli3	UTSW	13	15726256	missense	probably benign	0.00
R8167:Gli3	UTSW	13	15725643	missense	probably benign	0.00
R8170:Gli3	UTSW	13	15720208	missense	probably benign
R8199:Gli3	UTSW	13	15725991	missense	probably benign	0.08
R8247:Gli3	UTSW	13	15726775	missense	possibly damaging	0.82
R8332:Gli3	UTSW	13	15713548	missense	possibly damaging	0.58
R8347:Gli3	UTSW	13	15723525	missense	probably damaging	1.00
R8559:Gli3	UTSW	13	15660132	missense	probably damaging	1.00
R8676:Gli3	UTSW	13	15715034	missense	probably damaging	1.00
R8905:Gli3	UTSW	13	15726531	missense	probably benign	0.01
R9099:Gli3	UTSW	13	15726735	missense	probably damaging	1.00
R9260:Gli3	UTSW	13	15725090	missense	probably damaging	0.99
R9317:Gli3	UTSW	13	15715073	missense	probably damaging	1.00
R9475:Gli3	UTSW	13	15725711	missense	possibly damaging	0.87
R9546:Gli3	UTSW	13	15613858	missense	probably benign	0.00
R9571:Gli3	UTSW	13	15726273	missense	probably benign	0.00
R9621:Gli3	UTSW	13	15726668	missense	probably benign	0.01
R9704:Gli3	UTSW	13	15723473	missense	probably damaging	1.00
R9787:Gli3	UTSW	13	15725801	missense	probably damaging	0.96
RF010:Gli3	UTSW	13	15726369	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACAGGGATACATTGCCCATC -3'
(R):5'- CTGACTGAAGCCCATGGTTTG -3'

Sequencing Primer
(F):5'- ATCAGCTACTCAGTGGCAGCATG -3'
(R):5'- CCCATGGTTTGGTCATAGAACTGAC -3'

Posted On

2017-02-15