Incidental Mutation 'R0563:Rnf40'
ID46011
Institutional Source Beutler Lab
Gene Symbol Rnf40
Ensembl Gene ENSMUSG00000030816
Gene Namering finger protein 40
Synonyms
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127588767-127604799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127592876 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 398 (L398P)
Ref Sequence ENSEMBL: ENSMUSP00000146310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033088] [ENSMUST00000072155] [ENSMUST00000205694] [ENSMUST00000206914]
Predicted Effect probably damaging
Transcript: ENSMUST00000033088
AA Change: L358P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033088
Gene: ENSMUSG00000030816
AA Change: L358P

DomainStartEndE-ValueType
coiled coil region 55 86 N/A INTRINSIC
coiled coil region 189 209 N/A INTRINSIC
coiled coil region 231 377 N/A INTRINSIC
coiled coil region 437 525 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
coiled coil region 629 760 N/A INTRINSIC
coiled coil region 800 839 N/A INTRINSIC
RING 948 986 1.86e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072155
SMART Domains Protein: ENSMUSP00000072019
Gene: ENSMUSG00000057176

DomainStartEndE-ValueType
Pfam:CLAMP 130 228 3.1e-37 PFAM
low complexity region 243 274 N/A INTRINSIC
coiled coil region 285 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205694
AA Change: L398P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206724
Predicted Effect probably benign
Transcript: ENSMUST00000206914
Meta Mutation Damage Score 0.7855 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein was reported to interact with the tumor suppressor protein RB1. Studies of the rat counterpart suggested that this protein may function as an E3 ubiquitin-protein ligase, and facilitate the ubiquitination and degradation of syntaxin 1, which is an essential component of the neurotransmitter release machinery. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Rnf40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Rnf40 APN 7 127590716 splice site probably benign
IGL02331:Rnf40 APN 7 127589827 missense probably benign
IGL02626:Rnf40 APN 7 127596572 missense probably damaging 1.00
IGL02867:Rnf40 APN 7 127591429 nonsense probably null
IGL02889:Rnf40 APN 7 127591429 nonsense probably null
IGL03353:Rnf40 APN 7 127592891 nonsense probably null
R0103:Rnf40 UTSW 7 127600571 missense probably damaging 1.00
R0103:Rnf40 UTSW 7 127600571 missense probably damaging 1.00
R0133:Rnf40 UTSW 7 127596860 synonymous probably null
R0554:Rnf40 UTSW 7 127602584 missense probably damaging 1.00
R1523:Rnf40 UTSW 7 127590615 missense probably damaging 0.99
R1551:Rnf40 UTSW 7 127596334 missense possibly damaging 0.88
R1804:Rnf40 UTSW 7 127595948 missense possibly damaging 0.59
R1929:Rnf40 UTSW 7 127591784 missense probably damaging 0.99
R2194:Rnf40 UTSW 7 127597235 missense probably damaging 1.00
R2356:Rnf40 UTSW 7 127591576 missense probably damaging 0.99
R4839:Rnf40 UTSW 7 127592640 nonsense probably null
R5071:Rnf40 UTSW 7 127597286 missense probably damaging 1.00
R5074:Rnf40 UTSW 7 127597286 missense probably damaging 1.00
R5292:Rnf40 UTSW 7 127595948 missense possibly damaging 0.59
R5537:Rnf40 UTSW 7 127596089 missense probably benign 0.05
R5547:Rnf40 UTSW 7 127589130 critical splice donor site probably null
R5871:Rnf40 UTSW 7 127591585 missense probably damaging 0.97
R6767:Rnf40 UTSW 7 127596585 missense possibly damaging 0.88
R6834:Rnf40 UTSW 7 127596406 missense probably benign 0.18
R6969:Rnf40 UTSW 7 127596323 missense possibly damaging 0.89
R6980:Rnf40 UTSW 7 127594677 missense probably damaging 1.00
R7626:Rnf40 UTSW 7 127589875 missense probably benign
X0026:Rnf40 UTSW 7 127594695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGGACCAATGAGCGTCTCAAG -3'
(R):5'- GCCAAGGAACAATCTATGCCCAAGG -3'

Sequencing Primer
(F):5'- ATGAGCGTCTCAAGGTCGG -3'
(R):5'- TCTATGCCCAAGGGACTCTCAG -3'
Posted On2013-06-11