Incidental Mutation 'R6014:Arhgap21'
ID479893
Institutional Source Beutler Lab
Gene Symbol Arhgap21
Ensembl Gene ENSMUSG00000036591
Gene NameRho GTPase activating protein 21
SynonymsARHGAP10, 5530401C11Rik
MMRRC Submission 044190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R6014 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location20847919-20968881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20881805 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 26 (G26D)
Ref Sequence ENSEMBL: ENSMUSP00000133347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]
Predicted Effect probably damaging
Transcript: ENSMUST00000114594
AA Change: G191D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: G191D

DomainStartEndE-ValueType
PDZ 58 159 1.03e-16 SMART
low complexity region 351 362 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 911 925 N/A INTRINSIC
PH 930 1040 2.09e-16 SMART
RhoGAP 1157 1334 3.26e-62 SMART
low complexity region 1381 1399 N/A INTRINSIC
low complexity region 1448 1466 N/A INTRINSIC
low complexity region 1533 1565 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
low complexity region 1891 1900 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141298
AA Change: G197D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: G197D

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154230
AA Change: G197D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: G197D

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156142
Predicted Effect probably damaging
Transcript: ENSMUST00000173194
AA Change: G187D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: G187D

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 441 455 N/A INTRINSIC
low complexity region 621 631 N/A INTRINSIC
low complexity region 907 921 N/A INTRINSIC
PH 926 1036 2.09e-16 SMART
RhoGAP 1153 1330 3.26e-62 SMART
low complexity region 1377 1395 N/A INTRINSIC
low complexity region 1444 1462 N/A INTRINSIC
low complexity region 1529 1561 N/A INTRINSIC
low complexity region 1569 1589 N/A INTRINSIC
low complexity region 1887 1896 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174584
AA Change: G26D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: G26D

DomainStartEndE-ValueType
low complexity region 186 197 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 746 760 N/A INTRINSIC
PH 765 875 2.09e-16 SMART
RhoGAP 992 1169 3.26e-62 SMART
Meta Mutation Damage Score 0.5200 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A T 2: 35,354,869 M157K probably benign Het
A2ml1 C T 6: 128,571,985 C278Y probably damaging Het
Abcc2 A T 19: 43,826,735 Q1187L probably benign Het
Adcy9 A T 16: 4,418,819 Y6N probably damaging Het
Adh1 T C 3: 138,286,798 I225T probably benign Het
Akap11 A T 14: 78,512,499 I816K probably benign Het
Ap1b1 T A 11: 5,019,364 M240K possibly damaging Het
Apex1 A T 14: 50,925,525 T17S probably benign Het
Bahcc1 A G 11: 120,289,789 Y2613C probably benign Het
Baz1b C T 5: 135,217,394 R566W probably damaging Het
Casp8ap2 A T 4: 32,641,400 Y818F probably damaging Het
Col3a1 T A 1: 45,321,579 C56* probably null Het
Coro2a G A 4: 46,542,261 P371S probably damaging Het
Cyp2a22 T A 7: 26,939,180 probably null Het
Dpysl3 T A 18: 43,361,067 I183F probably damaging Het
Drc1 A T 5: 30,345,649 N172I probably damaging Het
Dst T C 1: 34,264,834 Y1378H probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l3 A T 17: 69,283,960 T91S probably damaging Het
Exoc4 T C 6: 33,475,997 V474A probably benign Het
Fam229b G A 10: 39,118,993 T56I probably damaging Het
Gfm2 A G 13: 97,151,661 probably null Het
Git2 C T 5: 114,733,877 E152K probably benign Het
Golt1b T A 6: 142,396,217 I109N probably damaging Het
Grid2ip T A 5: 143,387,823 M783K possibly damaging Het
Inpp5a A G 7: 139,574,982 Y339C probably damaging Het
Isoc2a T C 7: 4,891,626 S103P probably damaging Het
Itih4 C A 14: 30,892,629 Q483K probably benign Het
Kansl2 A G 15: 98,520,316 probably null Het
Kdm5d G A Y: 921,528 A509T probably benign Het
Krt13 A T 11: 100,117,611 D433E unknown Het
Lat2 C T 5: 134,603,454 V142M probably damaging Het
Lemd1 A C 1: 132,256,725 *102S probably null Het
Lrfn2 T C 17: 49,069,906 L5P possibly damaging Het
Lrrc4c T G 2: 97,629,212 probably null Het
Lypla1 T A 1: 4,808,371 probably null Het
Magi2 G A 5: 20,611,093 G744R probably damaging Het
Myh14 T A 7: 44,625,078 E948V probably null Het
Myo5a C A 9: 75,167,207 Y799* probably null Het
Nacc1 A C 8: 84,675,071 M371R possibly damaging Het
Nlrp5 T G 7: 23,409,947 M106R probably benign Het
Oas1h C T 5: 120,867,166 H226Y possibly damaging Het
Obscn A C 11: 59,038,864 I5175R probably damaging Het
Pcdh7 T A 5: 57,721,155 I684N probably damaging Het
Pcdhb3 T A 18: 37,302,653 N557K probably damaging Het
Pde3b T C 7: 114,416,440 L297S probably damaging Het
Pigv G T 4: 133,665,429 H143Q probably benign Het
Ptk2 T G 15: 73,304,444 Y251S possibly damaging Het
Ralgds A G 2: 28,543,661 N219S probably damaging Het
Sardh C A 2: 27,197,528 probably null Het
Serpina3b A T 12: 104,131,097 K212N possibly damaging Het
Sh3bp2 A G 5: 34,559,627 N461D probably benign Het
Shisa2 A T 14: 59,629,908 Q203L probably damaging Het
Shmt1 C A 11: 60,797,557 G255V probably damaging Het
Socs1 T A 16: 10,784,493 I127F possibly damaging Het
Srcap A T 7: 127,538,750 T1091S probably benign Het
Syt14 A G 1: 192,930,695 I599T probably damaging Het
Tep1 A T 14: 50,847,000 N907K probably benign Het
Themis2 A G 4: 132,785,980 Y312H probably benign Het
Tubgcp5 T G 7: 55,823,609 S812A probably benign Het
Ush2a A T 1: 188,850,040 I3767F probably damaging Het
Usp40 T A 1: 87,980,016 E626V probably damaging Het
Utrn T C 10: 12,690,876 R1181G probably benign Het
Vmn2r117 T A 17: 23,479,561 I13F probably damaging Het
Wdr34 C T 2: 30,031,751 A533T probably benign Het
Wdr48 G T 9: 119,924,709 V646F probably damaging Het
Wdr64 T C 1: 175,805,990 F936L possibly damaging Het
Other mutations in Arhgap21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Arhgap21 APN 2 20855700 missense probably damaging 1.00
IGL01472:Arhgap21 APN 2 20849581 missense probably damaging 1.00
IGL01634:Arhgap21 APN 2 20914644 missense probably benign 0.00
IGL01766:Arhgap21 APN 2 20849637 missense possibly damaging 0.68
IGL02097:Arhgap21 APN 2 20880002 missense probably benign 0.39
IGL02197:Arhgap21 APN 2 20880306 missense probably benign
IGL02264:Arhgap21 APN 2 20860039 splice site probably null
IGL02346:Arhgap21 APN 2 20879951 splice site probably benign
IGL02418:Arhgap21 APN 2 20880900 missense probably damaging 1.00
IGL02605:Arhgap21 APN 2 20855588 missense probably damaging 1.00
IGL02701:Arhgap21 APN 2 20892091 missense probably damaging 1.00
IGL03019:Arhgap21 APN 2 20861063 missense probably damaging 1.00
IGL03085:Arhgap21 APN 2 20914721 missense probably benign
IGL03265:Arhgap21 APN 2 20849628 missense probably benign 0.03
IGL03379:Arhgap21 APN 2 20880689 missense probably benign 0.41
R0304:Arhgap21 UTSW 2 20859801 splice site probably benign
R0363:Arhgap21 UTSW 2 20881133 missense probably damaging 1.00
R0498:Arhgap21 UTSW 2 20863117 missense probably damaging 1.00
R0539:Arhgap21 UTSW 2 20914799 nonsense probably null
R0633:Arhgap21 UTSW 2 20855387 nonsense probably null
R0905:Arhgap21 UTSW 2 20849934 missense possibly damaging 0.88
R1550:Arhgap21 UTSW 2 20881765 nonsense probably null
R1570:Arhgap21 UTSW 2 20880840 missense probably benign
R1686:Arhgap21 UTSW 2 20881848 missense probably damaging 1.00
R1746:Arhgap21 UTSW 2 20861099 missense probably damaging 0.99
R1864:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R1865:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R2209:Arhgap21 UTSW 2 20849520 missense probably damaging 1.00
R2211:Arhgap21 UTSW 2 20881640 missense possibly damaging 0.56
R2276:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2277:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2279:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2336:Arhgap21 UTSW 2 20880051 missense probably damaging 1.00
R2516:Arhgap21 UTSW 2 20854998 missense probably damaging 1.00
R3722:Arhgap21 UTSW 2 20850291 missense probably damaging 1.00
R3877:Arhgap21 UTSW 2 20859906 missense probably damaging 0.99
R4017:Arhgap21 UTSW 2 20892104 missense probably benign 0.10
R4232:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4233:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4234:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4235:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4236:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4434:Arhgap21 UTSW 2 20967335 missense probably benign
R4686:Arhgap21 UTSW 2 20863222 missense probably damaging 1.00
R4817:Arhgap21 UTSW 2 20850156 missense probably benign
R4834:Arhgap21 UTSW 2 20865319 missense probably damaging 1.00
R4845:Arhgap21 UTSW 2 20881187 missense probably damaging 0.99
R4889:Arhgap21 UTSW 2 20880468 missense probably benign 0.10
R4904:Arhgap21 UTSW 2 20850061 missense probably benign 0.00
R4911:Arhgap21 UTSW 2 20858989 missense probably damaging 1.00
R4994:Arhgap21 UTSW 2 20849890 missense probably benign 0.00
R5067:Arhgap21 UTSW 2 20880037 missense probably damaging 1.00
R5086:Arhgap21 UTSW 2 20848834 missense probably benign 0.00
R5281:Arhgap21 UTSW 2 20849316 missense probably damaging 1.00
R5364:Arhgap21 UTSW 2 20849722 missense probably damaging 1.00
R5420:Arhgap21 UTSW 2 20881086 missense probably damaging 0.99
R5476:Arhgap21 UTSW 2 20880686 missense probably benign 0.06
R5831:Arhgap21 UTSW 2 20863213 missense probably damaging 1.00
R5949:Arhgap21 UTSW 2 20849041 missense probably damaging 0.97
R5994:Arhgap21 UTSW 2 20881376 missense possibly damaging 0.78
R6739:Arhgap21 UTSW 2 20880732 missense possibly damaging 0.94
R6817:Arhgap21 UTSW 2 20880296 missense probably benign 0.23
R6821:Arhgap21 UTSW 2 20848848 missense probably benign
R6844:Arhgap21 UTSW 2 20881305 missense probably benign 0.00
R6870:Arhgap21 UTSW 2 20880510 missense probably damaging 1.00
R6891:Arhgap21 UTSW 2 20850331 missense probably damaging 0.97
R7011:Arhgap21 UTSW 2 20848878 missense possibly damaging 0.65
R7144:Arhgap21 UTSW 2 20865387 missense probably benign
R7237:Arhgap21 UTSW 2 20849972 nonsense probably null
R7261:Arhgap21 UTSW 2 20880366 missense probably benign
R7558:Arhgap21 UTSW 2 20855610 missense probably damaging 1.00
R7566:Arhgap21 UTSW 2 20912291 missense probably benign 0.17
R7738:Arhgap21 UTSW 2 20849479 missense probably damaging 1.00
R7738:Arhgap21 UTSW 2 20850358 missense probably damaging 1.00
R7820:Arhgap21 UTSW 2 20863172 missense probably damaging 1.00
R7822:Arhgap21 UTSW 2 20880713 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CAATGACGGTCCTCACACTC -3'
(R):5'- AAGAATGTACCCTGTGCTGTG -3'

Sequencing Primer
(F):5'- ACGGAGGCACTTGTATTTCC -3'
(R):5'- GTTTTGCATGCGCGCCAC -3'
Posted On2017-06-26