Mutagenetix > Incidental Mutation

Incidental Mutation 'R8487:Arhgap21'

657768

Institutional Source

Beutler Lab

Gene Symbol

Arhgap21

Ensembl Gene

ENSMUSG00000036591

Gene Name

Rho GTPase activating protein 21

Synonyms

ARHGAP10, 5530401C11Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.611) question?

Stock #

R8487 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20847919-20968881 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 20881305 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 354 (S354A)

Ref Sequence

ENSEMBL: ENSMUSP00000133851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114594
AA Change: S358A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: S358A

Domain	Start	End	E-Value	Type
PDZ	58	159	1.03e-16	SMART
low complexity region	351	362	N/A	INTRINSIC
low complexity region	445	459	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	911	925	N/A	INTRINSIC
PH	930	1040	2.09e-16	SMART
RhoGAP	1157	1334	3.26e-62	SMART
low complexity region	1381	1399	N/A	INTRINSIC
low complexity region	1448	1466	N/A	INTRINSIC
low complexity region	1533	1565	N/A	INTRINSIC
low complexity region	1573	1593	N/A	INTRINSIC
low complexity region	1891	1900	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141298
AA Change: S364A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: S364A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154230
AA Change: S364A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: S364A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173194
AA Change: S354A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: S354A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	441	455	N/A	INTRINSIC
low complexity region	621	631	N/A	INTRINSIC
low complexity region	907	921	N/A	INTRINSIC
PH	926	1036	2.09e-16	SMART
RhoGAP	1153	1330	3.26e-62	SMART
low complexity region	1377	1395	N/A	INTRINSIC
low complexity region	1444	1462	N/A	INTRINSIC
low complexity region	1529	1561	N/A	INTRINSIC
low complexity region	1569	1589	N/A	INTRINSIC
low complexity region	1887	1896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174584
AA Change: S193A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: S193A

Domain	Start	End	E-Value	Type
low complexity region	186	197	N/A	INTRINSIC
low complexity region	280	294	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
low complexity region	746	760	N/A	INTRINSIC
PH	765	875	2.09e-16	SMART
RhoGAP	992	1169	3.26e-62	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,859,486	I153V	probably benign	Het
Bcan	T	C	3: 87,989,209	T727A	probably damaging	Het
Brinp1	C	T	4: 68,829,455	G137E	probably damaging	Het
Catsperd	A	G	17: 56,663,419	Y697C	probably damaging	Het
Ccdc39	T	A	3: 33,832,659	K267*	probably null	Het
Ccdc47	C	A	11: 106,202,145	V92L	possibly damaging	Het
Cyp2c54	A	T	19: 40,071,546	I181N	probably damaging	Het
Ddx60	A	T	8: 61,974,150	D753V	probably damaging	Het
Dlg2	A	T	7: 92,286,588	K641N	probably damaging	Het
Eloa	G	A	4: 136,009,357	R527C	probably benign	Het
Fancd2	C	T	6: 113,568,226	P835L	probably damaging	Het
Fbln2	C	G	6: 91,250,864	T428S	probably damaging	Het
Fbn2	G	A	18: 58,020,390	A2600V	possibly damaging	Het
Gbe1	A	G	16: 70,436,988	Y251C	probably damaging	Het
Gnptab	T	A	10: 88,432,646		probably null	Het
Hspa1a	T	A	17: 34,972,057		probably benign	Het
Ifi204	G	A	1: 173,760,273	P107S	probably damaging	Het
Kif6	A	G	17: 49,671,136	I119V	probably damaging	Het
Lmntd2	G	A	7: 141,210,514	H554Y	probably benign	Het
Lrrc8e	C	A	8: 4,234,218	H148N	probably damaging	Het
Lrriq1	T	C	10: 103,215,053	N613D	probably damaging	Het
Map4k4	C	T	1: 39,988,976	T319M	probably damaging	Het
Mbtps1	C	T	8: 119,541,674	V253I	probably damaging	Het
Mcm4	C	A	16: 15,632,178	C330F	probably damaging	Het
Mok	A	G	12: 110,809,907		probably null	Het
Nedd4	T	C	9: 72,670,039	C49R	probably damaging	Het
Nlrp4e	T	C	7: 23,321,558	V490A	probably benign	Het
Nsf	A	T	11: 103,928,758	F27I	probably damaging	Het
Olfr1256	T	C	2: 89,835,265	N227D	probably benign	Het
Olfr1513	A	T	14: 52,349,239	L269Q	probably damaging	Het
Olfr301	A	G	7: 86,412,439	S26G	probably benign	Het
Olfr498	G	T	7: 108,465,577	M84I	possibly damaging	Het
Olfr798	A	G	10: 129,625,245	I272T	possibly damaging	Het
Pax1	A	G	2: 147,365,048	M1V	probably null	Het
Pcdhga12	A	G	18: 37,767,578	T488A	probably damaging	Het
Plekhh2	A	G	17: 84,557,481	D99G	possibly damaging	Het
Polr3h	T	C	15: 81,916,623	T173A	probably benign	Het
Pramel6	C	T	2: 87,508,701	L82F	probably damaging	Het
Ralgapa2	A	T	2: 146,388,543	I1034N	probably damaging	Het
Rbfox1	G	A	16: 7,224,455	V58I	probably damaging	Het
Reln	T	A	5: 21,899,029	I3315L	probably benign	Het
Rev3l	T	A	10: 39,806,848	S321T	probably damaging	Het
Ryr1	T	C	7: 29,040,867	T3908A	probably damaging	Het
Secisbp2l	G	T	2: 125,775,582	Y58*	probably null	Het
Sgms1	C	A	19: 32,125,297	V337L	probably benign	Het
Slc38a2	G	A	15: 96,695,291	Q136*	probably null	Het
Smarcd1	T	A	15: 99,707,776	V296D	probably damaging	Het
Smcr8	A	C	11: 60,783,996	H866P	probably damaging	Het
Spcs1	T	A	14: 31,000,764	I33L	probably benign	Het
Stxbp5	T	C	10: 9,812,289	R423G	possibly damaging	Het
Syt4	A	T	18: 31,443,737	M188K	possibly damaging	Het
Tchhl1	A	G	3: 93,469,562	D22G	probably damaging	Het
Tiparp	T	A	3: 65,546,234	N134K	probably benign	Het
Topaz1	A	G	9: 122,749,936	D637G	possibly damaging	Het
Trav14d-3-dv8	A	T	14: 53,078,735		probably benign	Het
Vmn1r19	A	T	6: 57,405,181	M240L	probably benign	Het
Vmn1r77	T	A	7: 12,041,587	S29T	probably damaging	Het
Vps13d	A	G	4: 145,155,247	F1253L	probably benign	Het
Zfp407	G	A	18: 84,562,770	R73*	probably null	Het
Zfp446	T	A	7: 12,982,628	F334I	possibly damaging	Het
Zfp654	A	T	16: 64,785,648	Y730*	probably null	Het

Other mutations in Arhgap21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Arhgap21	APN	2	20855700	missense	probably damaging	1.00
IGL01472:Arhgap21	APN	2	20849581	missense	probably damaging	1.00
IGL01634:Arhgap21	APN	2	20914644	missense	probably benign	0.00
IGL01766:Arhgap21	APN	2	20849637	missense	possibly damaging	0.68
IGL02097:Arhgap21	APN	2	20880002	missense	probably benign	0.39
IGL02197:Arhgap21	APN	2	20880306	missense	probably benign
IGL02264:Arhgap21	APN	2	20860039	splice site	probably null
IGL02346:Arhgap21	APN	2	20879951	splice site	probably benign
IGL02418:Arhgap21	APN	2	20880900	missense	probably damaging	1.00
IGL02605:Arhgap21	APN	2	20855588	missense	probably damaging	1.00
IGL02701:Arhgap21	APN	2	20892091	missense	probably damaging	1.00
IGL03019:Arhgap21	APN	2	20861063	missense	probably damaging	1.00
IGL03085:Arhgap21	APN	2	20914721	missense	probably benign
IGL03265:Arhgap21	APN	2	20849628	missense	probably benign	0.03
IGL03379:Arhgap21	APN	2	20880689	missense	probably benign	0.41
R0304:Arhgap21	UTSW	2	20859801	splice site	probably benign
R0363:Arhgap21	UTSW	2	20881133	missense	probably damaging	1.00
R0498:Arhgap21	UTSW	2	20863117	missense	probably damaging	1.00
R0539:Arhgap21	UTSW	2	20914799	nonsense	probably null
R0633:Arhgap21	UTSW	2	20855387	nonsense	probably null
R0905:Arhgap21	UTSW	2	20849934	missense	possibly damaging	0.88
R1550:Arhgap21	UTSW	2	20881765	nonsense	probably null
R1570:Arhgap21	UTSW	2	20880840	missense	probably benign
R1686:Arhgap21	UTSW	2	20881848	missense	probably damaging	1.00
R1746:Arhgap21	UTSW	2	20861099	missense	probably damaging	0.99
R1864:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R1865:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R2209:Arhgap21	UTSW	2	20849520	missense	probably damaging	1.00
R2211:Arhgap21	UTSW	2	20881640	missense	possibly damaging	0.56
R2276:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2277:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2279:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2336:Arhgap21	UTSW	2	20880051	missense	probably damaging	1.00
R2516:Arhgap21	UTSW	2	20854998	missense	probably damaging	1.00
R3722:Arhgap21	UTSW	2	20850291	missense	probably damaging	1.00
R3877:Arhgap21	UTSW	2	20859906	missense	probably damaging	0.99
R4017:Arhgap21	UTSW	2	20892104	missense	probably benign	0.10
R4232:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4233:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4234:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4235:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4236:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4434:Arhgap21	UTSW	2	20967335	missense	probably benign
R4686:Arhgap21	UTSW	2	20863222	missense	probably damaging	1.00
R4817:Arhgap21	UTSW	2	20850156	missense	probably benign
R4834:Arhgap21	UTSW	2	20865319	missense	probably damaging	1.00
R4845:Arhgap21	UTSW	2	20881187	missense	probably damaging	0.99
R4889:Arhgap21	UTSW	2	20880468	missense	probably benign	0.10
R4904:Arhgap21	UTSW	2	20850061	missense	probably benign	0.00
R4911:Arhgap21	UTSW	2	20858989	missense	probably damaging	1.00
R4994:Arhgap21	UTSW	2	20849890	missense	probably benign	0.00
R5067:Arhgap21	UTSW	2	20880037	missense	probably damaging	1.00
R5086:Arhgap21	UTSW	2	20848834	missense	probably benign	0.00
R5281:Arhgap21	UTSW	2	20849316	missense	probably damaging	1.00
R5364:Arhgap21	UTSW	2	20849722	missense	probably damaging	1.00
R5420:Arhgap21	UTSW	2	20881086	missense	probably damaging	0.99
R5476:Arhgap21	UTSW	2	20880686	missense	probably benign	0.06
R5831:Arhgap21	UTSW	2	20863213	missense	probably damaging	1.00
R5949:Arhgap21	UTSW	2	20849041	missense	probably damaging	0.97
R5994:Arhgap21	UTSW	2	20881376	missense	possibly damaging	0.78
R6014:Arhgap21	UTSW	2	20881805	missense	probably damaging	1.00
R6739:Arhgap21	UTSW	2	20880732	missense	possibly damaging	0.94
R6817:Arhgap21	UTSW	2	20880296	missense	probably benign	0.23
R6821:Arhgap21	UTSW	2	20848848	missense	probably benign
R6844:Arhgap21	UTSW	2	20881305	missense	probably benign	0.00
R6870:Arhgap21	UTSW	2	20880510	missense	probably damaging	1.00
R6891:Arhgap21	UTSW	2	20850331	missense	probably damaging	0.97
R7011:Arhgap21	UTSW	2	20848878	missense	possibly damaging	0.65
R7144:Arhgap21	UTSW	2	20865387	missense	probably benign
R7237:Arhgap21	UTSW	2	20849972	nonsense	probably null
R7261:Arhgap21	UTSW	2	20880366	missense	probably benign
R7558:Arhgap21	UTSW	2	20855610	missense	probably damaging	1.00
R7566:Arhgap21	UTSW	2	20912291	missense	probably benign	0.17
R7738:Arhgap21	UTSW	2	20849479	missense	probably damaging	1.00
R7738:Arhgap21	UTSW	2	20850358	missense	probably damaging	1.00
R7820:Arhgap21	UTSW	2	20863172	missense	probably damaging	1.00
R7822:Arhgap21	UTSW	2	20880713	missense	possibly damaging	0.80
R7965:Arhgap21	UTSW	2	20849196	missense	probably damaging	1.00
R7986:Arhgap21	UTSW	2	20863156	missense	probably damaging	1.00
R8028:Arhgap21	UTSW	2	20880405	missense	probably benign	0.02
R8209:Arhgap21	UTSW	2	20871745	missense	probably damaging	1.00
R8226:Arhgap21	UTSW	2	20871745	missense	probably damaging	1.00
R8251:Arhgap21	UTSW	2	20849410	missense	probably benign
R8486:Arhgap21	UTSW	2	20860425	missense	probably damaging	1.00
R8508:Arhgap21	UTSW	2	20854180	missense	probably benign	0.17
R8835:Arhgap21	UTSW	2	20967333	nonsense	probably null
R9140:Arhgap21	UTSW	2	20881214	missense	probably damaging	1.00
R9190:Arhgap21	UTSW	2	20854172	missense	probably null	0.04
R9204:Arhgap21	UTSW	2	20881005	missense	probably damaging	1.00
R9227:Arhgap21	UTSW	2	20855658	missense	possibly damaging	0.92
R9230:Arhgap21	UTSW	2	20855658	missense	possibly damaging	0.92
R9308:Arhgap21	UTSW	2	20849250	missense	probably damaging	0.99
R9374:Arhgap21	UTSW	2	20881586	missense	probably damaging	1.00
R9449:Arhgap21	UTSW	2	20880653	missense	probably benign
R9454:Arhgap21	UTSW	2	20865342	missense	probably damaging	0.99
R9499:Arhgap21	UTSW	2	20881586	missense	probably damaging	1.00
R9544:Arhgap21	UTSW	2	20854127	missense	possibly damaging	0.73
R9552:Arhgap21	UTSW	2	20881586	missense	probably damaging	1.00
R9567:Arhgap21	UTSW	2	20892142	missense	possibly damaging	0.94
R9588:Arhgap21	UTSW	2	20854127	missense	possibly damaging	0.73
R9749:Arhgap21	UTSW	2	20849215	missense	probably benign	0.00
Z1191:Arhgap21	UTSW	2	20881472	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- TATAGTCTGCTGCGCTCTGAG -3'
(R):5'- TCAGGTCCTTCACATAGAACTGAAG -3'

Sequencing Primer
(F):5'- CTCTGAGATGCAGCTCGTAAG -3'
(R):5'- CCTTCACATAGAACTGAAGAGGTAAG -3'

Posted On

2021-01-18