Incidental Mutation 'R0519:Ercc6'
List |< first << previous [record 19 of 72] next >> last >|
ID48415
Institutional Source Beutler Lab
Gene Symbol Ercc6
Ensembl Gene ENSMUSG00000054051
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6
SynonymsCS group B correcting gene, C130058G22Rik, CSB
MMRRC Submission 038712-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R0519 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32513521-32580990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 32526842 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 450 (D450A)
Ref Sequence ENSEMBL: ENSMUSP00000066256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066807]
Predicted Effect probably damaging
Transcript: ENSMUST00000066807
AA Change: D450A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: D450A

DomainStartEndE-ValueType
PDB:4CVO|A 82 160 1e-36 PDB
low complexity region 286 299 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 460 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
DEXDc 499 699 8.34e-33 SMART
Blast:DEXDc 720 821 7e-56 BLAST
HELICc 865 948 1.41e-21 SMART
low complexity region 1364 1377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228017
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 V99A probably benign Het
Asxl3 A G 18: 22,523,520 Q1529R possibly damaging Het
Atg12 T C 18: 46,741,410 E46G probably benign Het
Cdcp2 A G 4: 107,107,192 probably benign Het
Clasrp A G 7: 19,584,164 probably benign Het
Clip2 A G 5: 134,516,151 V383A probably benign Het
Cntln C T 4: 85,005,053 probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Csmd2 A C 4: 128,487,005 Y2118S possibly damaging Het
Dip2c T A 13: 9,563,208 V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 R755Q probably benign Het
Dsn1 A T 2: 156,998,713 probably benign Het
Dtd2 T C 12: 52,004,959 probably benign Het
Dync1i1 A G 6: 6,027,399 T602A probably benign Het
Fgf12 A T 16: 28,189,628 V104D probably benign Het
Frem1 A T 4: 82,970,633 probably null Het
Gcgr G T 11: 120,536,156 W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Hapln1 A G 13: 89,584,716 probably benign Het
Hmgn3 T C 9: 83,112,248 E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 A255V probably damaging Het
Hyls1 T C 9: 35,561,203 K306E probably damaging Het
Jcad C T 18: 4,649,122 probably benign Het
Kif14 C A 1: 136,469,147 A397E probably damaging Het
Lcmt2 A T 2: 121,139,344 probably null Het
Lifr T C 15: 7,177,580 L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 K209E possibly damaging Het
Macf1 G A 4: 123,471,320 T1651I probably benign Het
Mapk4 T C 18: 73,970,321 D39G probably damaging Het
Mbl1 A G 14: 41,158,565 M137V probably damaging Het
Mcm10 G A 2: 5,008,545 S92L probably benign Het
Mug1 A G 6: 121,851,424 K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 probably null Het
Neu3 G A 7: 99,823,317 probably benign Het
Nsd1 A G 13: 55,312,835 T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 Y195F probably benign Het
Olfr3 T A 2: 36,812,615 H159L probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Olfr854 A T 9: 19,566,949 I145N probably benign Het
Osgepl1 T C 1: 53,321,096 V327A probably damaging Het
Pcdhb21 T C 18: 37,516,032 V738A possibly damaging Het
Plekha8 A T 6: 54,622,107 probably benign Het
Ptprq A C 10: 107,538,920 probably benign Het
Pus10 T A 11: 23,711,201 F263Y probably benign Het
Rad54b A T 4: 11,599,809 I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 F756L probably damaging Het
Scn11a A G 9: 119,790,119 L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 V253I possibly damaging Het
Slc39a4 A T 15: 76,615,138 N192K probably benign Het
Soat1 T A 1: 156,441,246 I245F probably damaging Het
Sorcs2 G A 5: 36,031,190 A858V probably benign Het
Tcim T C 8: 24,438,635 T88A possibly damaging Het
Tecta G A 9: 42,347,892 probably benign Het
Tgm5 C A 2: 121,048,895 L553F probably damaging Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmem214 A C 5: 30,869,668 M1L probably null Het
Togaram1 T C 12: 64,966,002 probably benign Het
Topaz1 C A 9: 122,749,479 L485I possibly damaging Het
Ttn T C 2: 76,718,282 probably benign Het
Ube2o A G 11: 116,546,459 probably null Het
Ubr7 T A 12: 102,768,206 D246E probably benign Het
Vcpkmt T C 12: 69,582,328 D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 A118T probably benign Het
Zp2 A G 7: 120,138,149 I272T probably damaging Het
Other mutations in Ercc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ercc6 APN 14 32568072 missense probably damaging 1.00
IGL00796:Ercc6 APN 14 32570002 missense probably benign 0.01
IGL00916:Ercc6 APN 14 32562655 intron probably benign
IGL01743:Ercc6 APN 14 32552604 missense probably damaging 1.00
IGL01802:Ercc6 APN 14 32562574 missense probably damaging 0.99
IGL01886:Ercc6 APN 14 32569580 missense possibly damaging 0.90
IGL02100:Ercc6 APN 14 32517095 missense probably benign 0.00
IGL02115:Ercc6 APN 14 32576993 missense probably damaging 1.00
IGL02755:Ercc6 APN 14 32575748 splice site probably benign
IGL02964:Ercc6 APN 14 32570103 missense probably benign 0.00
IGL02998:Ercc6 APN 14 32557857 missense probably benign 0.05
IGL03150:Ercc6 APN 14 32558574 missense probably damaging 0.96
R0152:Ercc6 UTSW 14 32546905 critical splice donor site probably benign
R0591:Ercc6 UTSW 14 32558016 splice site probably benign
R0894:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R0946:Ercc6 UTSW 14 32552621 missense probably benign 0.08
R1313:Ercc6 UTSW 14 32552720 splice site probably benign
R1506:Ercc6 UTSW 14 32569864 missense probably benign 0.01
R1528:Ercc6 UTSW 14 32519022 missense probably damaging 0.98
R1711:Ercc6 UTSW 14 32526176 missense probably damaging 1.00
R1753:Ercc6 UTSW 14 32576999 missense probably benign
R1795:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R1843:Ercc6 UTSW 14 32546820 missense probably damaging 0.99
R1853:Ercc6 UTSW 14 32576816 missense possibly damaging 0.86
R1859:Ercc6 UTSW 14 32526778 missense probably damaging 1.00
R1912:Ercc6 UTSW 14 32576803 missense probably damaging 1.00
R2308:Ercc6 UTSW 14 32566409 missense possibly damaging 0.70
R2322:Ercc6 UTSW 14 32526317 missense probably damaging 1.00
R2386:Ercc6 UTSW 14 32541359 splice site probably null
R4170:Ercc6 UTSW 14 32566797 missense probably damaging 1.00
R4369:Ercc6 UTSW 14 32517207 missense probably damaging 0.96
R4389:Ercc6 UTSW 14 32574908 nonsense probably null
R4747:Ercc6 UTSW 14 32569907 missense probably benign 0.00
R4811:Ercc6 UTSW 14 32574929 missense probably benign 0.20
R4840:Ercc6 UTSW 14 32541296 missense probably damaging 1.00
R4973:Ercc6 UTSW 14 32574902 missense probably damaging 1.00
R5068:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5069:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5070:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5093:Ercc6 UTSW 14 32567522 missense probably damaging 1.00
R5265:Ercc6 UTSW 14 32569623 missense probably benign 0.01
R5272:Ercc6 UTSW 14 32519028 nonsense probably null
R5499:Ercc6 UTSW 14 32516959 start codon destroyed probably null 0.98
R5795:Ercc6 UTSW 14 32526352 missense probably damaging 0.98
R6258:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6260:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6267:Ercc6 UTSW 14 32526403 nonsense probably null
R6291:Ercc6 UTSW 14 32569986 missense probably benign 0.01
R6296:Ercc6 UTSW 14 32526403 nonsense probably null
R6361:Ercc6 UTSW 14 32517110 missense probably benign 0.00
R6500:Ercc6 UTSW 14 32526823 missense probably damaging 0.96
R6555:Ercc6 UTSW 14 32517107 missense probably benign 0.15
R6724:Ercc6 UTSW 14 32566331 missense probably benign 0.01
R6925:Ercc6 UTSW 14 32562608 missense probably damaging 0.99
R7143:Ercc6 UTSW 14 32570305 missense probably damaging 1.00
R7327:Ercc6 UTSW 14 32526404 missense probably benign 0.19
R7396:Ercc6 UTSW 14 32569805 missense probably benign 0.00
R7529:Ercc6 UTSW 14 32560729 nonsense probably null
R7609:Ercc6 UTSW 14 32566361 missense probably benign 0.11
R7802:Ercc6 UTSW 14 32517303 missense probably damaging 1.00
R7854:Ercc6 UTSW 14 32566292 missense probably damaging 1.00
R7995:Ercc6 UTSW 14 32562569 missense probably damaging 0.99
R8181:Ercc6 UTSW 14 32557948 missense probably damaging 1.00
R8320:Ercc6 UTSW 14 32521015 missense probably benign 0.01
R8388:Ercc6 UTSW 14 32570340 utr 3 prime probably benign
Z1176:Ercc6 UTSW 14 32526487 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CCAAGTGCTCTCTCAGACAGACAAG -3'
(R):5'- TCCACTAAGGACTCCATGTCCAGG -3'

Sequencing Primer
(F):5'- gatggggaggaggaggaag -3'
(R):5'- ACTCCATGTCCAGGTTCTTGTG -3'
Posted On2013-06-12