Incidental Mutation 'R6179:Tanc1'
ID487916
Institutional Source Beutler Lab
Gene Symbol Tanc1
Ensembl Gene ENSMUSG00000035168
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms1200003E16Rik
MMRRC Submission 044321-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6179 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location59612042-59846149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59842976 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1468 (Q1468R)
Ref Sequence ENSEMBL: ENSMUSP00000108187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]
Predicted Effect probably benign
Transcript: ENSMUST00000037526
AA Change: Q1475R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: Q1475R

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112568
AA Change: Q1468R

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: Q1468R

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 448 468 N/A INTRINSIC
ANK 886 918 1.06e3 SMART
ANK 922 953 2.43e3 SMART
ANK 957 986 1.12e-3 SMART
Blast:ANK 990 1021 7e-12 BLAST
ANK 1030 1059 1.78e3 SMART
ANK 1068 1097 2.34e-1 SMART
ANK 1101 1130 3.71e-4 SMART
ANK 1134 1163 1.51e-4 SMART
ANK 1167 1196 4.89e-4 SMART
ANK 1200 1229 3.01e-4 SMART
ANK 1233 1262 1.99e2 SMART
TPR 1279 1312 7.49e1 SMART
TPR 1326 1359 2.35e-1 SMART
TPR 1360 1393 6.29e-2 SMART
low complexity region 1409 1425 N/A INTRINSIC
low complexity region 1447 1476 N/A INTRINSIC
low complexity region 1649 1679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139863
AA Change: Q1475R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: Q1475R

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147650
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930426L09Rik T C 2: 18,998,842 probably benign Het
4930590J08Rik T C 6: 91,942,330 S657P probably damaging Het
Abca9 T C 11: 110,134,254 I988V probably benign Het
Aox4 T A 1: 58,231,503 D280E probably benign Het
Apob T A 12: 8,005,060 L1353* probably null Het
Atp2b1 C T 10: 99,022,829 R222C probably damaging Het
AW209491 T G 13: 14,637,083 S174A possibly damaging Het
B930094E09Rik G C 18: 31,609,858 probably benign Het
Cbln3 G T 14: 55,884,060 P43Q possibly damaging Het
Ccdc181 A T 1: 164,279,918 T57S probably benign Het
Ccr2 A C 9: 124,105,971 N96T probably damaging Het
Cep131 T C 11: 120,066,011 I868V probably benign Het
Chd2 A G 7: 73,444,323 I1535T probably damaging Het
Chl1 A T 6: 103,683,243 T377S probably benign Het
Cpeb3 A G 19: 37,088,453 F439L probably damaging Het
Crb2 T C 2: 37,790,257 V399A probably damaging Het
Cry2 C T 2: 92,413,842 G329R probably damaging Het
Dock4 A G 12: 40,731,869 E691G probably benign Het
Edil3 A T 13: 88,821,989 H3L probably benign Het
Endod1 T C 9: 14,357,461 I243V probably benign Het
Fpr3 G A 17: 17,970,657 W63* probably null Het
Gm498 A G 7: 143,871,787 T58A probably benign Het
Gtse1 T G 15: 85,868,957 N424K possibly damaging Het
Kcnt1 G A 2: 25,893,180 V252M probably damaging Het
Kif1bp G A 10: 62,563,250 Q130* probably null Het
Lmbrd2 T G 15: 9,149,175 I48M probably damaging Het
Lrrc7 T G 3: 158,353,432 I13L probably damaging Het
Mbd4 A G 6: 115,845,425 S408P probably benign Het
Mphosph10 A G 7: 64,378,781 V542A possibly damaging Het
Msto1 C A 3: 88,910,947 R331L probably damaging Het
Myh10 G A 11: 68,802,153 E1425K probably damaging Het
Nup43 T C 10: 7,678,673 I340T probably benign Het
Olfr350 T C 2: 36,850,834 S263P possibly damaging Het
Pcm1 T A 8: 41,283,632 M884K probably damaging Het
Phf20 T A 2: 156,298,653 L749H probably damaging Het
Pigp T C 16: 94,370,367 R22G probably null Het
Polr2b T C 5: 77,320,977 M200T probably damaging Het
Ppig T A 2: 69,750,127 D668E unknown Het
Prss3 G A 6: 41,375,126 R68C probably benign Het
Retreg3 G A 11: 101,103,895 probably benign Het
Shank1 T C 7: 44,357,206 F2116L possibly damaging Het
Spg21 T C 9: 65,468,808 S33P possibly damaging Het
Spns3 A G 11: 72,499,523 S432P probably damaging Het
Stra6 A G 9: 58,135,169 E27G probably damaging Het
Tbce T G 13: 14,019,777 E99A probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trim10 A G 17: 36,877,031 T380A probably damaging Het
Trim31 T A 17: 36,909,609 D472E probably damaging Het
Vmn2r28 G A 7: 5,488,004 Q415* probably null Het
Vwf G A 6: 125,649,289 C7Y unknown Het
Yeats2 C T 16: 20,214,475 P1088L probably benign Het
Zfp40 C A 17: 23,178,380 V48L possibly damaging Het
Other mutations in Tanc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tanc1 APN 2 59790841 missense possibly damaging 0.84
IGL00484:Tanc1 APN 2 59793176 missense probably benign 0.00
IGL00688:Tanc1 APN 2 59815391 missense probably damaging 1.00
IGL00765:Tanc1 APN 2 59806301 missense probably benign 0.15
IGL01576:Tanc1 APN 2 59797735 missense probably damaging 1.00
IGL01590:Tanc1 APN 2 59785473 missense probably benign
IGL02016:Tanc1 APN 2 59843590 missense probably benign 0.00
IGL02373:Tanc1 APN 2 59796028 critical splice donor site probably null
IGL02539:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02540:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02541:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02543:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02559:Tanc1 APN 2 59724654 splice site probably benign
IGL02626:Tanc1 APN 2 59799872 missense probably damaging 1.00
IGL02669:Tanc1 APN 2 59799986 missense probably damaging 1.00
IGL02902:Tanc1 APN 2 59793087 splice site probably benign
Oreja UTSW 2 59791804 synonymous silent
R0178:Tanc1 UTSW 2 59835447 nonsense probably null
R0347:Tanc1 UTSW 2 59842991 missense probably benign
R0570:Tanc1 UTSW 2 59796038 splice site probably benign
R0660:Tanc1 UTSW 2 59843884 nonsense probably null
R0664:Tanc1 UTSW 2 59843884 nonsense probably null
R0898:Tanc1 UTSW 2 59790788 missense probably damaging 1.00
R1333:Tanc1 UTSW 2 59843491 missense probably benign
R1575:Tanc1 UTSW 2 59791651 missense probably damaging 1.00
R1608:Tanc1 UTSW 2 59797694 missense possibly damaging 0.80
R1616:Tanc1 UTSW 2 59785387 missense probably damaging 1.00
R1703:Tanc1 UTSW 2 59843021 missense probably benign 0.02
R1727:Tanc1 UTSW 2 59790809 missense probably damaging 1.00
R1809:Tanc1 UTSW 2 59800097 missense probably damaging 1.00
R1812:Tanc1 UTSW 2 59791679 missense probably damaging 1.00
R1925:Tanc1 UTSW 2 59724751 missense possibly damaging 0.48
R1951:Tanc1 UTSW 2 59791812 missense possibly damaging 0.92
R2174:Tanc1 UTSW 2 59843833 missense possibly damaging 0.72
R2228:Tanc1 UTSW 2 59724724 missense probably benign 0.04
R2267:Tanc1 UTSW 2 59837219 critical splice donor site probably null
R4191:Tanc1 UTSW 2 59839013 missense probably damaging 1.00
R4476:Tanc1 UTSW 2 59841996 splice site probably null
R4632:Tanc1 UTSW 2 59795835 missense probably damaging 1.00
R4825:Tanc1 UTSW 2 59699422 missense probably damaging 1.00
R4982:Tanc1 UTSW 2 59799943 missense probably damaging 1.00
R5338:Tanc1 UTSW 2 59795834 missense probably damaging 1.00
R5657:Tanc1 UTSW 2 59834707 splice site probably null
R5672:Tanc1 UTSW 2 59772353 missense possibly damaging 0.81
R5703:Tanc1 UTSW 2 59795997 missense probably damaging 0.98
R5707:Tanc1 UTSW 2 59758530 missense probably benign
R5778:Tanc1 UTSW 2 59699347 critical splice acceptor site probably null
R5795:Tanc1 UTSW 2 59807582 missense possibly damaging 0.62
R5831:Tanc1 UTSW 2 59785341 missense possibly damaging 0.89
R5849:Tanc1 UTSW 2 59799904 missense probably benign 0.00
R5912:Tanc1 UTSW 2 59791686 missense possibly damaging 0.92
R5944:Tanc1 UTSW 2 59837220 critical splice donor site probably null
R6057:Tanc1 UTSW 2 59817493 missense possibly damaging 0.46
R6142:Tanc1 UTSW 2 59833222 nonsense probably null
R6185:Tanc1 UTSW 2 59791585 splice site probably null
R6192:Tanc1 UTSW 2 59838961 splice site probably null
R6196:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6197:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6230:Tanc1 UTSW 2 59842031 missense probably damaging 1.00
R6275:Tanc1 UTSW 2 59843510 missense probably benign 0.22
R6415:Tanc1 UTSW 2 59837114 missense probably benign 0.02
R6480:Tanc1 UTSW 2 59807642 missense probably damaging 1.00
R6578:Tanc1 UTSW 2 59795954 missense probably damaging 1.00
R6786:Tanc1 UTSW 2 59791806 missense probably benign 0.00
R7006:Tanc1 UTSW 2 59795844 missense probably damaging 1.00
R7133:Tanc1 UTSW 2 59797609 missense probably benign 0.16
R7381:Tanc1 UTSW 2 59785326 missense probably damaging 1.00
R7422:Tanc1 UTSW 2 59806344 missense probably benign 0.02
RF028:Tanc1 UTSW 2 59843269 small deletion probably benign
RF049:Tanc1 UTSW 2 59843269 small deletion probably benign
X0063:Tanc1 UTSW 2 59843980 nonsense probably null
X0064:Tanc1 UTSW 2 59844112 missense probably damaging 1.00
Z1176:Tanc1 UTSW 2 59772529 missense possibly damaging 0.93
Z1177:Tanc1 UTSW 2 59790887 missense probably benign
Z1177:Tanc1 UTSW 2 59791830 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGCAAGCAACTCCAGAG -3'
(R):5'- TTCTCATGCTAGATTGCCCGG -3'

Sequencing Primer
(F):5'- TCCAGAGGAACCAGCAGC -3'
(R):5'- TAGATTGCCCGGAACCCAGATG -3'
Posted On2017-10-10