Incidental Mutation 'R0534:Rmdn3'
ID49354
Institutional Source Beutler Lab
Gene Symbol Rmdn3
Ensembl Gene ENSMUSG00000070730
Gene Nameregulator of microtubule dynamics 3
Synonyms
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0534 (G1)
Quality Score176
Status Validated
Chromosome2
Chromosomal Location119137001-119157034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119146370 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 294 (E294G)
Ref Sequence ENSEMBL: ENSMUSP00000092283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094695]
Predicted Effect probably benign
Transcript: ENSMUST00000094695
AA Change: E294G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000092283
Gene: ENSMUSG00000070730
AA Change: E294G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 91 122 N/A INTRINSIC
low complexity region 135 148 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
SCOP:d1hxia_ 354 445 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130249
Predicted Effect probably benign
Transcript: ENSMUST00000151406
SMART Domains Protein: ENSMUSP00000117939
Gene: ENSMUSG00000027323

DomainStartEndE-ValueType
Pfam:Rad51 1 196 5.4e-103 PFAM
Pfam:AAA_25 2 152 1.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156332
Meta Mutation Damage Score 0.0909 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Rmdn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Rmdn3 APN 2 119153947 missense probably damaging 1.00
IGL01684:Rmdn3 APN 2 119147574 missense probably damaging 1.00
IGL02892:Rmdn3 APN 2 119154080 missense probably benign 0.00
R1126:Rmdn3 UTSW 2 119153995 missense probably benign 0.01
R2332:Rmdn3 UTSW 2 119153527 unclassified probably benign
R3850:Rmdn3 UTSW 2 119156422 missense possibly damaging 0.65
R5034:Rmdn3 UTSW 2 119147577 missense probably damaging 1.00
R5221:Rmdn3 UTSW 2 119156454 missense probably damaging 1.00
R5942:Rmdn3 UTSW 2 119147577 missense probably damaging 1.00
R6049:Rmdn3 UTSW 2 119153425 missense probably damaging 1.00
R6188:Rmdn3 UTSW 2 119139350 critical splice donor site probably null
R7011:Rmdn3 UTSW 2 119138423 missense probably damaging 1.00
R7181:Rmdn3 UTSW 2 119139368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCACCGTGCTACTCACTG -3'
(R):5'- AGGTCATTCAACAATTCCCTCAGGC -3'

Sequencing Primer
(F):5'- CAGACCTGCTATCTCAGAGGAG -3'
(R):5'- GAAGCCGACAAGACTTTCTG -3'
Posted On2013-06-12