Incidental Mutation 'R0534:Igf2bp1'
ID 49379
Institutional Source Beutler Lab
Gene Symbol Igf2bp1
Ensembl Gene ENSMUSG00000013415
Gene Name insulin-like growth factor 2 mRNA binding protein 1
Synonyms IMP-1, Zbp1, D030026A21Rik, D11Moh45, CRD-BP, D11Moh40e, Crdbp
MMRRC Submission 038726-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.273) question?
Stock # R0534 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 95957163-96005940 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 95966796 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000013559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013559]
AlphaFold O88477
Predicted Effect probably benign
Transcript: ENSMUST00000013559
SMART Domains Protein: ENSMUSP00000013559
Gene: ENSMUSG00000013415

RRM 3 71 7.42e-9 SMART
RRM 82 152 5.25e-9 SMART
KH 194 265 7.75e-14 SMART
KH 275 348 7.34e-15 SMART
low complexity region 377 390 N/A INTRINSIC
KH 404 475 1.91e-13 SMART
KH 486 558 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175617
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mutation of this locus results in increased neonatal lethality, growth retardation, and impaired intestinal development. Males exhibit increased anxiety-like response and decreased exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Igf2bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02554:Igf2bp1 APN 11 95974168 missense probably damaging 0.97
IGL03263:Igf2bp1 APN 11 95966673 missense probably damaging 1.00
R0011:Igf2bp1 UTSW 11 96005584 missense probably damaging 0.96
R0011:Igf2bp1 UTSW 11 96005584 missense probably damaging 0.96
R0098:Igf2bp1 UTSW 11 95973163 missense probably damaging 1.00
R0348:Igf2bp1 UTSW 11 95968893 missense possibly damaging 0.59
R2025:Igf2bp1 UTSW 11 95974170 missense possibly damaging 0.95
R2026:Igf2bp1 UTSW 11 95974170 missense possibly damaging 0.95
R2103:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R2104:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R5021:Igf2bp1 UTSW 11 95974006 missense probably damaging 0.98
R5154:Igf2bp1 UTSW 11 95963547 nonsense probably null
R6123:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R6130:Igf2bp1 UTSW 11 95974020 missense probably damaging 1.00
R6736:Igf2bp1 UTSW 11 95973122 missense probably benign 0.14
R7173:Igf2bp1 UTSW 11 95968464 missense probably benign
R7748:Igf2bp1 UTSW 11 95967587 missense probably benign 0.03
R8722:Igf2bp1 UTSW 11 95970780 missense possibly damaging 0.65
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gctgtgaacttgtgatcctg -3'
Posted On 2013-06-12