Mutagenetix > Incidental Mutation

Incidental Mutation 'R5525:Shank2'

431820

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

043083-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5525 (G1)

Quality Score

161

Status

Not validated

Chromosome

Chromosomal Location

143555665-143978231 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143623846 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 277 (D277G)

Ref Sequence

ENSEMBL: ENSMUSP00000101522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105902] [ENSMUST00000213146]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000105902
AA Change: D277G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: D277G

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213146
AA Change: D277G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 78,749,731 (GRCm39)	T1501A	probably benign	Het
Acin1	G	A	14: 54,901,848 (GRCm39)	A648V	possibly damaging	Het
Agap1	A	G	1: 89,671,495 (GRCm39)	T401A	possibly damaging	Het
Anapc4	T	G	5: 53,014,151 (GRCm39)	M440R	probably damaging	Het
Ankrd26	A	G	6: 118,504,692 (GRCm39)	M739T	probably benign	Het
Brip1	T	C	11: 86,001,273 (GRCm39)	E721G	possibly damaging	Het
Bzw1	A	G	1: 58,442,065 (GRCm39)	E221G	possibly damaging	Het
Cenpm	A	C	15: 82,123,492 (GRCm39)		probably null	Het
Exosc1	T	A	19: 41,912,457 (GRCm39)	K143N	probably damaging	Het
Fgd5	T	A	6: 92,043,228 (GRCm39)	L1236Q	probably damaging	Het
Gemin6	T	G	17: 80,535,178 (GRCm39)	V46G	probably damaging	Het
Grm3	C	T	5: 9,554,872 (GRCm39)	V807I	probably damaging	Het
Kndc1	A	G	7: 139,504,026 (GRCm39)	N1110S	probably benign	Het
Magi1	A	T	6: 93,769,354 (GRCm39)	V17D	possibly damaging	Het
Mdn1	T	G	4: 32,767,961 (GRCm39)	M5298R	possibly damaging	Het
Nlrp9c	T	A	7: 26,083,926 (GRCm39)	E551V	probably damaging	Het
Oacyl	A	C	18: 65,878,427 (GRCm39)	I457L	probably benign	Het
Or12d13	C	T	17: 37,647,517 (GRCm39)	G202D	probably damaging	Het
Or5p69	A	G	7: 107,967,206 (GRCm39)	I170V	probably benign	Het
Or5t17	A	T	2: 86,832,683 (GRCm39)	E123D	possibly damaging	Het
Rab11fip3	T	C	17: 26,210,269 (GRCm39)	E996G	probably damaging	Het
Rabep1	T	A	11: 70,813,972 (GRCm39)	S554T	probably damaging	Het
Rln1	T	C	19: 29,311,920 (GRCm39)	E26G	probably benign	Het
Rpf1	A	G	3: 146,223,559 (GRCm39)		silent	Het
Sdk1	T	C	5: 142,171,020 (GRCm39)	V1961A	possibly damaging	Het
Serpinb8	A	T	1: 107,535,023 (GRCm39)	I365F	probably damaging	Het
Snapc4	ACTGCTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGC	2: 26,259,538 (GRCm39)		probably benign	Het
Thsd7a	T	C	6: 12,332,006 (GRCm39)	T1269A	possibly damaging	Het
Ttll3	A	G	6: 113,389,939 (GRCm39)	N776D	probably benign	Het
Unc80	A	G	1: 66,645,773 (GRCm39)	E1483G	possibly damaging	Het
Ush2a	A	G	1: 188,485,803 (GRCm39)	D2971G	probably benign	Het
Zfp322a	A	G	13: 23,541,685 (GRCm39)	V19A	probably benign	Het
Zfp462	C	A	4: 55,050,281 (GRCm39)	P2164T	possibly damaging	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	143,965,584 (GRCm39)	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	143,964,512 (GRCm39)	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	143,965,008 (GRCm39)	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	143,838,805 (GRCm39)	nonsense	probably null
IGL01996:Shank2	APN	7	143,965,230 (GRCm39)	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	143,838,784 (GRCm39)	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	143,965,008 (GRCm39)	missense	probably benign	0.01
IGL02320:Shank2	APN	7	143,974,681 (GRCm39)	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	143,963,373 (GRCm39)	missense	probably benign	0.03
IGL02997:Shank2	APN	7	143,635,610 (GRCm39)	missense	probably benign	0.16
R0077:Shank2	UTSW	7	143,746,204 (GRCm39)	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	143,964,314 (GRCm39)	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	143,585,092 (GRCm39)	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	143,623,872 (GRCm39)	missense	probably benign	0.04
R0644:Shank2	UTSW	7	143,965,586 (GRCm39)	missense	probably benign
R1072:Shank2	UTSW	7	143,965,305 (GRCm39)	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	143,965,457 (GRCm39)	missense	probably benign	0.00
R1424:Shank2	UTSW	7	143,606,109 (GRCm39)	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	143,964,890 (GRCm39)	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	143,733,590 (GRCm39)	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	143,964,336 (GRCm39)	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	143,740,595 (GRCm39)	nonsense	probably null
R2074:Shank2	UTSW	7	143,963,277 (GRCm39)	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	143,964,971 (GRCm39)	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	143,611,455 (GRCm39)	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	143,965,314 (GRCm39)	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	143,606,042 (GRCm39)	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	143,622,507 (GRCm39)	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	143,623,792 (GRCm39)	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	143,635,611 (GRCm39)	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	143,959,121 (GRCm39)	missense	probably benign
R3907:Shank2	UTSW	7	143,963,313 (GRCm39)	missense	probably damaging	1.00
R3938:Shank2	UTSW	7	143,682,112 (GRCm39)	missense	probably benign	0.20
R4151:Shank2	UTSW	7	143,608,565 (GRCm39)	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	143,733,518 (GRCm39)	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	143,964,599 (GRCm39)	missense	probably benign	0.09
R4519:Shank2	UTSW	7	143,963,942 (GRCm39)	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	143,965,161 (GRCm39)	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	143,964,159 (GRCm39)	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	143,965,566 (GRCm39)	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	143,974,342 (GRCm39)	missense	probably benign	0.07
R4751:Shank2	UTSW	7	143,963,205 (GRCm39)	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	143,606,043 (GRCm39)	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	143,585,146 (GRCm39)	missense	probably benign	0.17
R4929:Shank2	UTSW	7	143,965,008 (GRCm39)	missense	probably benign	0.01
R5009:Shank2	UTSW	7	143,623,916 (GRCm39)	missense	probably benign	0.00
R5027:Shank2	UTSW	7	143,812,842 (GRCm39)	nonsense	probably null
R5165:Shank2	UTSW	7	143,963,373 (GRCm39)	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	143,622,612 (GRCm39)	critical splice donor site	probably null
R5332:Shank2	UTSW	7	143,965,029 (GRCm39)	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	143,963,271 (GRCm39)	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	143,963,871 (GRCm39)	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	143,960,960 (GRCm39)	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	143,733,768 (GRCm39)	missense	probably benign	0.12
R6306:Shank2	UTSW	7	143,963,417 (GRCm39)	missense	probably benign	0.00
R6317:Shank2	UTSW	7	143,838,821 (GRCm39)	missense	possibly damaging	0.89
R6358:Shank2	UTSW	7	143,585,034 (GRCm39)	missense	probably benign	0.25
R6364:Shank2	UTSW	7	143,964,146 (GRCm39)	missense	probably benign	0.14
R6413:Shank2	UTSW	7	143,963,955 (GRCm39)	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	143,974,603 (GRCm39)	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	143,963,631 (GRCm39)	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	143,606,197 (GRCm39)	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	143,645,515 (GRCm39)	missense	probably benign	0.19
R6983:Shank2	UTSW	7	143,635,585 (GRCm39)	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	143,964,096 (GRCm39)	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	143,964,901 (GRCm39)	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	143,965,289 (GRCm39)	missense	probably benign	0.00
R7213:Shank2	UTSW	7	143,585,146 (GRCm39)	missense	probably benign	0.17
R7225:Shank2	UTSW	7	143,838,762 (GRCm39)	missense	probably benign	0.42
R7325:Shank2	UTSW	7	143,965,422 (GRCm39)	missense	probably benign	0.04
R7605:Shank2	UTSW	7	143,645,516 (GRCm39)	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	143,965,131 (GRCm39)	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	143,964,798 (GRCm39)	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	143,963,612 (GRCm39)	missense	probably benign	0.01
R8722:Shank2	UTSW	7	143,729,485 (GRCm39)	intron	probably benign
R8866:Shank2	UTSW	7	143,964,986 (GRCm39)	missense	probably benign
R8919:Shank2	UTSW	7	143,965,265 (GRCm39)	missense	probably damaging	1.00
R8944:Shank2	UTSW	7	143,623,927 (GRCm39)	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	143,965,236 (GRCm39)	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	143,963,705 (GRCm39)	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	143,622,535 (GRCm39)	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	143,963,705 (GRCm39)	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	143,960,945 (GRCm39)	missense	probably benign	0.00
R9362:Shank2	UTSW	7	143,963,271 (GRCm39)	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	143,964,752 (GRCm39)	missense	possibly damaging	0.77
R9524:Shank2	UTSW	7	143,964,183 (GRCm39)	missense	possibly damaging	0.71
R9557:Shank2	UTSW	7	143,963,847 (GRCm39)	missense	probably benign	0.00
R9559:Shank2	UTSW	7	143,585,041 (GRCm39)	missense	probably benign	0.30
R9574:Shank2	UTSW	7	143,622,462 (GRCm39)	missense	possibly damaging	0.90
R9680:Shank2	UTSW	7	143,964,837 (GRCm39)	missense	probably damaging	0.96
R9720:Shank2	UTSW	7	143,682,137 (GRCm39)	missense	probably damaging	0.99
RF009:Shank2	UTSW	7	143,965,308 (GRCm39)	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	143,682,114 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GATTGGCAGTTAGGACTCTCC -3'
(R):5'- GTAAACTTTTCAGGGCCCGG -3'

Sequencing Primer
(F):5'- AATCAGGTGTCCAGGCATGTCTC -3'
(R):5'- TTTTCAGGGCCCGGCACTC -3'

Posted On

2016-10-05