Mutagenetix > Incidental Mutation

Incidental Mutation 'R5525:Shank2'

431820

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

043083-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5525 (G1)

Quality Score

161

Status

Not validated

Chromosome

Chromosomal Location

144001928-144424494 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 144070109 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 277 (D277G)

Ref Sequence

ENSEMBL: ENSMUSP00000101522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105902] [ENSMUST00000213146]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000105902
AA Change: D277G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: D277G

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213146
AA Change: D277G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 79,099,983	T1501A	probably benign	Het
Acin1	G	A	14: 54,664,391	A648V	possibly damaging	Het
Agap1	A	G	1: 89,743,773	T401A	possibly damaging	Het
Anapc4	T	G	5: 52,856,809	M440R	probably damaging	Het
Ankrd26	A	G	6: 118,527,731	M739T	probably benign	Het
Brip1	T	C	11: 86,110,447	E721G	possibly damaging	Het
Bzw1	A	G	1: 58,402,906	E221G	possibly damaging	Het
Cenpm	A	C	15: 82,239,291		probably null	Het
Exosc1	T	A	19: 41,924,018	K143N	probably damaging	Het
Fgd5	T	A	6: 92,066,247	L1236Q	probably damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Grm3	C	T	5: 9,504,872	V807I	probably damaging	Het
Kndc1	A	G	7: 139,924,111	N1110S	probably benign	Het
Magi1	A	T	6: 93,792,373	V17D	possibly damaging	Het
Mdn1	T	G	4: 32,767,961	M5298R	possibly damaging	Het
Nlrp9c	T	A	7: 26,384,501	E551V	probably damaging	Het
Oacyl	A	C	18: 65,745,356	I457L	probably benign	Het
Olfr103	C	T	17: 37,336,626	G202D	probably damaging	Het
Olfr1102	A	T	2: 87,002,339	E123D	possibly damaging	Het
Olfr494	A	G	7: 108,367,999	I170V	probably benign	Het
Rab11fip3	T	C	17: 25,991,295	E996G	probably damaging	Het
Rabep1	T	A	11: 70,923,146	S554T	probably damaging	Het
Rln1	T	C	19: 29,334,520	E26G	probably benign	Het
Rpf1	A	G	3: 146,517,804		silent	Het
Sdk1	T	C	5: 142,185,265	V1961A	possibly damaging	Het
Serpinb8	A	T	1: 107,607,293	I365F	probably damaging	Het
Snapc4	ACTGCTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGC	2: 26,369,526		probably benign	Het
Thsd7a	T	C	6: 12,332,007	T1269A	possibly damaging	Het
Ttll3	A	G	6: 113,412,978	N776D	probably benign	Het
Unc80	A	G	1: 66,606,614	E1483G	possibly damaging	Het
Ush2a	A	G	1: 188,753,606	D2971G	probably benign	Het
Zfp322a	A	G	13: 23,357,515	V19A	probably benign	Het
Zfp462	C	A	4: 55,050,281	P2164T	possibly damaging	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	144411847	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	144410775	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	144411271	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	144285068	nonsense	probably null
IGL01996:Shank2	APN	7	144411493	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	144285047	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	144411271	missense	probably benign	0.01
IGL02320:Shank2	APN	7	144420944	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	144409636	missense	probably benign	0.03
IGL02997:Shank2	APN	7	144081873	missense	probably benign	0.16
R0077:Shank2	UTSW	7	144192467	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	144410577	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	144031355	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	144070135	missense	probably benign	0.04
R0644:Shank2	UTSW	7	144411849	missense	probably benign
R1072:Shank2	UTSW	7	144411568	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	144411720	missense	probably benign	0.00
R1424:Shank2	UTSW	7	144052372	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	144411153	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	144179853	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	144410599	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	144186858	nonsense	probably null
R2074:Shank2	UTSW	7	144409540	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	144411234	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	144057718	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	144411577	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	144052305	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	144068770	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	144070055	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	144081874	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	144405384	missense	probably benign
R3907:Shank2	UTSW	7	144409576	missense	probably damaging	1.00
R3938:Shank2	UTSW	7	144128375	missense	probably benign	0.20
R4151:Shank2	UTSW	7	144054828	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	144179781	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	144410862	missense	probably benign	0.09
R4519:Shank2	UTSW	7	144410205	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	144411424	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	144410422	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	144411829	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	144420605	missense	probably benign	0.07
R4751:Shank2	UTSW	7	144409468	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	144052306	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R4929:Shank2	UTSW	7	144411271	missense	probably benign	0.01
R5009:Shank2	UTSW	7	144070179	missense	probably benign	0.00
R5027:Shank2	UTSW	7	144259105	nonsense	probably null
R5165:Shank2	UTSW	7	144409636	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	144068875	critical splice donor site	probably null
R5332:Shank2	UTSW	7	144411292	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	144410134	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	144407223	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	144180031	missense	probably benign	0.12
R6306:Shank2	UTSW	7	144409680	missense	probably benign	0.00
R6317:Shank2	UTSW	7	144285084	missense	possibly damaging	0.89
R6358:Shank2	UTSW	7	144031297	missense	probably benign	0.25
R6364:Shank2	UTSW	7	144410409	missense	probably benign	0.14
R6413:Shank2	UTSW	7	144410218	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	144420866	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	144409894	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	144052460	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	144091778	missense	probably benign	0.19
R6983:Shank2	UTSW	7	144081848	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	144410359	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	144411164	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	144411552	missense	probably benign	0.00
R7213:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R7225:Shank2	UTSW	7	144285025	missense	probably benign	0.42
R7325:Shank2	UTSW	7	144411685	missense	probably benign	0.04
R7605:Shank2	UTSW	7	144091779	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	144411394	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	144411061	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	144409875	missense	probably benign	0.01
R8722:Shank2	UTSW	7	144175748	intron	probably benign
R8866:Shank2	UTSW	7	144411249	missense	probably benign
R8919:Shank2	UTSW	7	144411528	missense	probably damaging	1.00
R8944:Shank2	UTSW	7	144070190	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	144411499	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	144068798	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	144407208	missense	probably benign	0.00
R9362:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	144411015	missense	possibly damaging	0.77
R9524:Shank2	UTSW	7	144410446	missense	possibly damaging	0.71
R9557:Shank2	UTSW	7	144410110	missense	probably benign	0.00
R9559:Shank2	UTSW	7	144031304	missense	probably benign	0.30
R9574:Shank2	UTSW	7	144068725	missense	possibly damaging	0.90
R9680:Shank2	UTSW	7	144411100	missense	probably damaging	0.96
R9720:Shank2	UTSW	7	144128400	missense	probably damaging	0.99
RF009:Shank2	UTSW	7	144411571	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	144128377	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GATTGGCAGTTAGGACTCTCC -3'
(R):5'- GTAAACTTTTCAGGGCCCGG -3'

Sequencing Primer
(F):5'- AATCAGGTGTCCAGGCATGTCTC -3'
(R):5'- TTTTCAGGGCCCGGCACTC -3'

Posted On

2016-10-05