Incidental Mutation 'R6244:Or2ak7'
ID 505467
Institutional Source Beutler Lab
Gene Symbol Or2ak7
Ensembl Gene ENSMUSG00000107711
Gene Name olfactory receptor family 2 subfamily AK member 7
Synonyms MOR285-4, GA_x6K02T2NKPP-730312-729392, Olfr320, GA_x6K02T2NKPP-733777-732813, MOR285-5, Olfr321-ps1
MMRRC Submission 044435-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.226) question?
Stock # R6244 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 58574701-58575621 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58574830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 44 (T44S)
Ref Sequence ENSEMBL: ENSMUSP00000150051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204718] [ENSMUST00000214662]
AlphaFold Q7TRZ4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122047
Predicted Effect possibly damaging
Transcript: ENSMUST00000204718
AA Change: T44S

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145531
Gene: ENSMUSG00000107711
AA Change: T44S

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 8.4e-45 PFAM
Pfam:7tm_1 41 290 1.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214662
AA Change: T44S

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik T C 2: 155,845,150 (GRCm39) H113R possibly damaging Het
Adgrf3 A T 5: 30,402,531 (GRCm39) M499K probably benign Het
Adgrv1 G A 13: 81,255,050 (GRCm39) T211I probably damaging Het
Adss2 C T 1: 177,604,395 (GRCm39) E153K probably benign Het
Ago4 C A 4: 126,405,280 (GRCm39) G431V possibly damaging Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Atp2b4 T A 1: 133,654,299 (GRCm39) I769F probably damaging Het
Atp9a T C 2: 168,531,272 (GRCm39) probably null Het
Bltp1 T C 3: 37,011,148 (GRCm39) V1782A probably benign Het
Brap C A 5: 121,803,372 (GRCm39) D173E probably benign Het
Brca2 G T 5: 150,490,443 (GRCm39) R3035L probably benign Het
Ccdc8 C A 7: 16,730,176 (GRCm39) P555Q probably benign Het
Ccser2 A G 14: 36,662,675 (GRCm39) S170P probably benign Het
Celsr2 T C 3: 108,300,444 (GRCm39) H860R probably damaging Het
Cenpc1 C A 5: 86,194,244 (GRCm39) R174M probably damaging Het
Cfap57 T G 4: 118,436,607 (GRCm39) I930L probably damaging Het
Cx3cr1 C T 9: 119,880,760 (GRCm39) R214H probably damaging Het
Cyp4f14 T A 17: 33,125,291 (GRCm39) H429L probably benign Het
D5Ertd579e A G 5: 36,772,620 (GRCm39) F592L probably damaging Het
Ddb1 A G 19: 10,603,287 (GRCm39) E865G probably damaging Het
Ddx50 A T 10: 62,457,345 (GRCm39) probably null Het
Dpp6 A G 5: 27,254,626 (GRCm39) T14A probably damaging Het
Echs1 C A 7: 139,692,982 (GRCm39) Q51H possibly damaging Het
Ecm2 A T 13: 49,683,783 (GRCm39) D587V probably damaging Het
Ect2l A T 10: 18,016,145 (GRCm39) Y666N possibly damaging Het
Epha2 G A 4: 141,044,223 (GRCm39) G342S probably benign Het
Fbxo33 C A 12: 59,252,865 (GRCm39) K211N probably benign Het
Fchsd2 A G 7: 100,908,983 (GRCm39) probably null Het
Fen1 A G 19: 10,178,051 (GRCm39) V131A probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Flnb A G 14: 7,892,092 (GRCm38) E587G probably damaging Het
Foxd3 A G 4: 99,545,477 (GRCm39) T206A possibly damaging Het
Fut1 A G 7: 45,268,730 (GRCm39) E228G possibly damaging Het
Galnt13 T C 2: 54,823,560 (GRCm39) F379L probably damaging Het
Gcnt2 A C 13: 41,014,717 (GRCm39) E296A probably damaging Het
Gm7145 T A 1: 117,913,870 (GRCm39) C251S probably damaging Het
Gpam G A 19: 55,059,417 (GRCm39) P810L probably damaging Het
Il1rl2 T A 1: 40,366,726 (GRCm39) L87M possibly damaging Het
Itgae A G 11: 73,036,427 (GRCm39) S1122G probably damaging Het
Kcnh7 T A 2: 63,012,570 (GRCm39) D46V probably damaging Het
Kcnn3 T G 3: 89,552,830 (GRCm39) Y511* probably null Het
Kdm3b T A 18: 34,926,058 (GRCm39) I66N probably damaging Het
Klk1b27 A T 7: 43,703,974 (GRCm39) H39L probably benign Het
Kmo C T 1: 175,487,261 (GRCm39) T404I possibly damaging Het
Krt222 C T 11: 99,125,884 (GRCm39) probably null Het
Magi3 G C 3: 103,923,013 (GRCm39) H1235D probably benign Het
Mapk8ip1 C A 2: 92,219,589 (GRCm39) G81C probably damaging Het
Med15 G A 16: 17,470,609 (GRCm39) Q583* probably null Het
Mroh2a T C 1: 88,184,476 (GRCm39) V1453A probably benign Het
Myh13 A G 11: 67,253,327 (GRCm39) M1488V probably benign Het
Naip2 A T 13: 100,288,645 (GRCm39) F1193L probably damaging Het
Nop58 T A 1: 59,742,014 (GRCm39) M181K probably damaging Het
Npepps A T 11: 97,104,616 (GRCm39) V796D probably damaging Het
Nr1d1 A G 11: 98,661,363 (GRCm39) F301S probably damaging Het
Nynrin G A 14: 56,105,485 (GRCm39) V832I probably damaging Het
Or13a28 C A 7: 140,218,346 (GRCm39) S244Y probably damaging Het
Or1j14 T A 2: 36,418,353 (GRCm39) C310S probably benign Het
Or4e1 T A 14: 52,701,352 (GRCm39) Y38F probably damaging Het
Or8k1 T A 2: 86,047,566 (GRCm39) T163S possibly damaging Het
Phrf1 T A 7: 140,817,586 (GRCm39) C132S probably damaging Het
Plekhn1 T C 4: 156,315,015 (GRCm39) probably null Het
Polr2a G A 11: 69,635,052 (GRCm39) T569M probably damaging Het
Prr29 A G 11: 106,267,458 (GRCm39) probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,229,115 (GRCm39) probably benign Homo
Sc5d T C 9: 42,166,717 (GRCm39) E274G probably benign Het
Serpina1d A T 12: 103,731,087 (GRCm39) probably null Het
Serpinb11 T A 1: 107,299,972 (GRCm39) I106N probably damaging Het
Setd2 G A 9: 110,377,733 (GRCm39) R516K probably damaging Het
Sirt2 G T 7: 28,487,222 (GRCm39) C291F probably damaging Het
Stac3 T C 10: 127,344,044 (GRCm39) V314A probably damaging Het
Stat6 C T 10: 127,493,581 (GRCm39) probably null Het
Strn3 A G 12: 51,656,890 (GRCm39) V712A probably damaging Het
Tmc5 G T 7: 118,233,437 (GRCm39) G84C possibly damaging Het
Tnik C A 3: 28,704,328 (GRCm39) L996I probably damaging Het
Trim30d G T 7: 104,136,817 (GRCm39) T129K probably damaging Het
Triml1 G T 8: 43,591,793 (GRCm39) Y188* probably null Het
Trpc7 A G 13: 56,921,705 (GRCm39) Y760H probably damaging Het
Uaca G A 9: 60,777,326 (GRCm39) R571Q probably damaging Het
Ubash3a A T 17: 31,458,246 (GRCm39) Q575L possibly damaging Het
Usp49 T A 17: 47,983,827 (GRCm39) C61* probably null Het
Vmn2r18 A T 5: 151,508,116 (GRCm39) V336E probably damaging Het
Vwa8 T C 14: 79,324,102 (GRCm39) V1135A probably benign Het
Zcchc4 T C 5: 52,940,503 (GRCm39) V24A probably benign Het
Zfp354c A G 11: 50,705,798 (GRCm39) Y426H probably benign Het
Other mutations in Or2ak7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Or2ak7 APN 11 58,575,095 (GRCm39) missense probably damaging 1.00
IGL02293:Or2ak7 APN 11 58,574,996 (GRCm39) missense probably benign 0.01
IGL03001:Or2ak7 APN 11 58,574,702 (GRCm39) start codon destroyed probably null 1.00
IGL03039:Or2ak7 APN 11 58,574,837 (GRCm39) missense probably damaging 0.98
R0064:Or2ak7 UTSW 11 58,575,301 (GRCm39) missense probably benign 0.00
R1506:Or2ak7 UTSW 11 58,575,014 (GRCm39) missense probably benign 0.13
R4255:Or2ak7 UTSW 11 58,574,791 (GRCm39) missense probably damaging 1.00
R4345:Or2ak7 UTSW 11 58,574,771 (GRCm39) missense possibly damaging 0.63
R4646:Or2ak7 UTSW 11 58,575,556 (GRCm39) missense probably damaging 0.99
R4951:Or2ak7 UTSW 11 58,575,589 (GRCm39) missense probably damaging 0.98
R5591:Or2ak7 UTSW 11 58,574,951 (GRCm39) missense probably benign 0.36
R6325:Or2ak7 UTSW 11 58,575,354 (GRCm39) nonsense probably null
R7894:Or2ak7 UTSW 11 58,575,500 (GRCm39) missense possibly damaging 0.94
R8852:Or2ak7 UTSW 11 58,574,966 (GRCm39) missense probably benign 0.01
R8860:Or2ak7 UTSW 11 58,574,966 (GRCm39) missense probably benign 0.01
R9076:Or2ak7 UTSW 11 58,574,722 (GRCm39) missense probably benign 0.05
Z1186:Or2ak7 UTSW 11 58,575,083 (GRCm39) missense probably benign
Z1186:Or2ak7 UTSW 11 58,574,815 (GRCm39) missense probably benign
Z1186:Or2ak7 UTSW 11 58,574,758 (GRCm39) missense probably benign
Z1186:Or2ak7 UTSW 11 58,575,289 (GRCm39) missense probably benign 0.00
Z1187:Or2ak7 UTSW 11 58,574,815 (GRCm39) missense probably benign
Z1187:Or2ak7 UTSW 11 58,574,758 (GRCm39) missense probably benign
Z1187:Or2ak7 UTSW 11 58,575,548 (GRCm39) missense probably benign
Z1187:Or2ak7 UTSW 11 58,575,289 (GRCm39) missense probably benign 0.00
Z1187:Or2ak7 UTSW 11 58,575,083 (GRCm39) missense probably benign
Z1187:Or2ak7 UTSW 11 58,574,941 (GRCm39) missense probably benign
Z1188:Or2ak7 UTSW 11 58,574,815 (GRCm39) missense probably benign
Z1188:Or2ak7 UTSW 11 58,574,941 (GRCm39) missense probably benign
Z1188:Or2ak7 UTSW 11 58,575,083 (GRCm39) missense probably benign
Z1188:Or2ak7 UTSW 11 58,575,289 (GRCm39) missense probably benign 0.00
Z1188:Or2ak7 UTSW 11 58,575,541 (GRCm39) missense probably benign
Z1188:Or2ak7 UTSW 11 58,575,548 (GRCm39) missense probably benign
Z1188:Or2ak7 UTSW 11 58,574,758 (GRCm39) missense probably benign
Z1189:Or2ak7 UTSW 11 58,575,289 (GRCm39) missense probably benign 0.00
Z1189:Or2ak7 UTSW 11 58,575,083 (GRCm39) missense probably benign
Z1189:Or2ak7 UTSW 11 58,574,758 (GRCm39) missense probably benign
Z1190:Or2ak7 UTSW 11 58,574,758 (GRCm39) missense probably benign
Z1190:Or2ak7 UTSW 11 58,575,548 (GRCm39) missense probably benign
Z1190:Or2ak7 UTSW 11 58,575,541 (GRCm39) missense probably benign
Z1190:Or2ak7 UTSW 11 58,575,289 (GRCm39) missense probably benign 0.00
Z1190:Or2ak7 UTSW 11 58,575,083 (GRCm39) missense probably benign
Z1190:Or2ak7 UTSW 11 58,574,941 (GRCm39) missense probably benign
Z1190:Or2ak7 UTSW 11 58,574,815 (GRCm39) missense probably benign
Z1191:Or2ak7 UTSW 11 58,574,758 (GRCm39) missense probably benign
Z1191:Or2ak7 UTSW 11 58,575,548 (GRCm39) missense probably benign
Z1191:Or2ak7 UTSW 11 58,575,541 (GRCm39) missense probably benign
Z1191:Or2ak7 UTSW 11 58,575,289 (GRCm39) missense probably benign 0.00
Z1191:Or2ak7 UTSW 11 58,575,083 (GRCm39) missense probably benign
Z1191:Or2ak7 UTSW 11 58,574,941 (GRCm39) missense probably benign
Z1191:Or2ak7 UTSW 11 58,574,815 (GRCm39) missense probably benign
Z1192:Or2ak7 UTSW 11 58,575,083 (GRCm39) missense probably benign
Z1192:Or2ak7 UTSW 11 58,574,815 (GRCm39) missense probably benign
Z1192:Or2ak7 UTSW 11 58,574,758 (GRCm39) missense probably benign
Z1192:Or2ak7 UTSW 11 58,575,289 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCAATGACAGTCCTCACCTGG -3'
(R):5'- TAGGACATGAAGCCCAGCAG -3'

Sequencing Primer
(F):5'- GCCACGCCCTTTCCAGAG -3'
(R):5'- AGGAGGGCTTCAGATCCAC -3'
Posted On 2018-02-28