Incidental Mutation 'R6248:Vmn2r120'
ID505646
Institutional Source Beutler Lab
Gene Symbol Vmn2r120
Ensembl Gene ENSMUSG00000090655
Gene Namevomeronasal 2, receptor 120
SynonymsEG224916
Accession Numbers

Genbank: NM_001104591; MGI: 3644483

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6248 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57508783-57545314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57545287 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 10 (F10I)
Ref Sequence ENSEMBL: ENSMUSP00000129296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165781]
Predicted Effect probably benign
Transcript: ENSMUST00000165781
AA Change: F10I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129296
Gene: ENSMUSG00000090655
AA Change: F10I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 80 474 5.9e-42 PFAM
Pfam:NCD3G 517 570 7.5e-22 PFAM
Pfam:7tm_3 598 836 1.3e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (92/92)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T C 1: 160,075,408 S83P possibly damaging Het
Actr10 A T 12: 70,952,959 E176D probably benign Het
Adcy3 G A 12: 4,208,662 probably null Het
AI429214 T A 8: 36,994,124 I142N probably damaging Het
Alox12 A G 11: 70,253,110 L148S probably damaging Het
Ank3 A G 10: 69,973,850 I1147V probably benign Het
Apoc2 C T 7: 19,673,568 V12I probably benign Het
Arap3 T C 18: 37,991,354 S311G probably benign Het
Arih2 G T 9: 108,611,642 H292Q probably damaging Het
Cdc14a A T 3: 116,308,194 D312E probably benign Het
Cdh12 T G 15: 21,237,714 W12G possibly damaging Het
Cisd2 A T 3: 135,408,855 N118K probably damaging Het
Cntnap5b A G 1: 100,072,102 Q195R probably benign Het
Cyp2r1 A G 7: 114,562,731 probably null Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 T A 2: 180,660,255 H1952L probably damaging Het
Dnah10 T A 5: 124,794,219 probably null Het
Dnal4 T A 15: 79,762,513 M56L probably damaging Het
Emilin2 A G 17: 71,274,117 V538A probably benign Het
Eps8l2 A G 7: 141,342,102 D31G probably damaging Het
Erp44 A T 4: 48,219,479 L112* probably null Het
Etl4 C T 2: 20,809,089 T1907I possibly damaging Het
Exoc3 A G 13: 74,182,281 F510L probably benign Het
Fam114a2 G T 11: 57,493,116 T324K possibly damaging Het
Fer1l4 G A 2: 156,046,171 R465C probably damaging Het
Frmd4b A C 6: 97,459,212 S2R probably benign Het
Fscn1 A T 5: 142,961,023 D192V possibly damaging Het
Gm15922 C A 7: 3,736,338 E510D probably benign Het
Gm3486 T A 14: 41,484,515 *200C probably null Het
Gusb A T 5: 130,000,525 H138Q probably benign Het
Hdac9 A T 12: 34,528,294 M4K possibly damaging Het
Hhipl1 G T 12: 108,318,705 R439L probably benign Het
Hoxd9 A G 2: 74,698,636 E194G probably benign Het
Itgb1 A G 8: 128,722,421 S503G possibly damaging Het
Kcnt2 T A 1: 140,509,478 C500S probably damaging Het
Kdm7a G A 6: 39,147,049 S727L possibly damaging Het
Klhdc4 A G 8: 121,813,768 F92L probably damaging Het
Klrb1a A G 6: 128,619,174 V62A probably damaging Het
Krit1 A G 5: 3,813,032 probably null Het
Krt40 A G 11: 99,541,740 I150T possibly damaging Het
Larp4b A G 13: 9,158,702 T464A probably benign Het
Lrrc52 T G 1: 167,466,395 D107A probably damaging Het
Mapkap1 G T 2: 34,518,680 V35F probably damaging Het
Mccc1 A G 3: 35,990,164 V171A probably damaging Het
Metap1d A T 2: 71,515,760 R222* probably null Het
Mrgpre G A 7: 143,780,866 A300V probably benign Het
Mterf1b C A 5: 4,196,606 N82K probably benign Het
Myh9 C T 15: 77,785,222 W533* probably null Het
Myom2 A G 8: 15,098,472 probably null Het
Ncor1 G A 11: 62,366,982 P329S probably damaging Het
Nr2f1 T C 13: 78,196,492 probably benign Het
Olfr1348 A T 7: 6,501,676 C183* probably null Het
Olfr1361 A T 13: 21,659,074 I83N possibly damaging Het
Olfr417 T G 1: 174,369,670 V251G probably benign Het
Olfr47 C T 6: 43,235,904 Q99* probably null Het
Olfr551 T C 7: 102,588,030 T238A probably benign Het
Olfr800 A G 10: 129,660,663 I286V probably benign Het
Olfr96 T A 17: 37,225,560 L145* probably null Het
Pcdha11 T C 18: 37,005,897 L193P probably benign Het
Pcdhb20 T A 18: 37,506,232 F604I probably damaging Het
Pde1a T C 2: 79,878,201 H291R probably damaging Het
Pfkm G A 15: 98,126,379 V423M probably damaging Het
Pkd2l1 G T 19: 44,157,669 Q149K probably benign Het
Pkhd1l1 T A 15: 44,529,559 N1763K probably benign Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Prpf39 A C 12: 65,042,754 N89H probably damaging Het
Rad54l2 A G 9: 106,710,338 F743L probably damaging Het
Raver2 A G 4: 101,134,123 probably null Het
Ric8b T C 10: 84,947,845 L189P probably damaging Het
Sccpdh T C 1: 179,668,392 F13L probably benign Het
Scd2 T C 19: 44,303,009 F296L probably damaging Het
Scg2 G T 1: 79,436,306 D233E probably benign Het
Sema5b C A 16: 35,628,007 probably null Het
Skint5 A T 4: 113,779,089 V644E unknown Het
Slc44a5 G T 3: 154,264,041 V612F possibly damaging Het
Snd1 C T 6: 28,520,235 R107* probably null Het
Sun5 G T 2: 153,860,669 T189K probably damaging Het
Tap1 A T 17: 34,193,177 E452V probably damaging Het
Tcam1 A G 11: 106,282,826 N32S probably benign Het
Tep1 T C 14: 50,830,258 E2167G probably damaging Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmem175 T C 5: 108,645,955 V317A probably damaging Het
Tsga13 A G 6: 30,897,204 V231A probably benign Het
Tspan12 A G 6: 21,799,971 S126P probably damaging Het
Uvrag G T 7: 98,988,191 D143E probably damaging Het
Vmn1r230 T A 17: 20,846,774 M75K possibly damaging Het
Vmn2r57 T C 7: 41,399,860 T822A probably benign Het
Vmn2r67 T C 7: 85,150,560 Y490C probably damaging Het
Zc3h7b T A 15: 81,783,185 W644R probably damaging Het
Zeb1 A G 18: 5,766,962 D491G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp831 A T 2: 174,644,515 T328S possibly damaging Het
Other mutations in Vmn2r120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r120 APN 17 57525732 missense possibly damaging 0.86
IGL01346:Vmn2r120 APN 17 57545232 missense probably benign 0.11
IGL01996:Vmn2r120 APN 17 57525222 missense possibly damaging 0.92
IGL02503:Vmn2r120 APN 17 57509385 missense probably benign 0.40
IGL02582:Vmn2r120 APN 17 57524724 missense probably damaging 0.99
IGL02747:Vmn2r120 APN 17 57524719 missense probably benign 0.19
IGL02896:Vmn2r120 APN 17 57509008 missense probably damaging 1.00
IGL03139:Vmn2r120 APN 17 57524742 missense probably benign 0.39
IGL03342:Vmn2r120 APN 17 57509372 missense probably benign 0.03
A4554:Vmn2r120 UTSW 17 57525715 missense probably benign 0.01
R0207:Vmn2r120 UTSW 17 57525052 missense probably benign 0.17
R0472:Vmn2r120 UTSW 17 57524518 missense probably benign 0.03
R0517:Vmn2r120 UTSW 17 57508949 missense probably damaging 1.00
R1109:Vmn2r120 UTSW 17 57525829 missense probably benign 0.09
R1316:Vmn2r120 UTSW 17 57525939 missense probably benign 0.28
R1543:Vmn2r120 UTSW 17 57522374 missense probably benign 0.09
R1795:Vmn2r120 UTSW 17 57525038 missense probably benign 0.35
R1850:Vmn2r120 UTSW 17 57525826 missense probably benign 0.19
R1920:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1921:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1922:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R2063:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2064:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2065:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2067:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2286:Vmn2r120 UTSW 17 57508958 missense probably damaging 1.00
R2291:Vmn2r120 UTSW 17 57509479 missense probably damaging 1.00
R3416:Vmn2r120 UTSW 17 57509241 missense possibly damaging 0.89
R3874:Vmn2r120 UTSW 17 57524954 missense probably benign 0.40
R4023:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4024:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4348:Vmn2r120 UTSW 17 57522466 missense possibly damaging 0.47
R4409:Vmn2r120 UTSW 17 57509477 missense probably damaging 1.00
R4610:Vmn2r120 UTSW 17 57509120 missense probably damaging 1.00
R4771:Vmn2r120 UTSW 17 57524887 missense probably damaging 1.00
R4786:Vmn2r120 UTSW 17 57522048 missense probably benign 0.14
R4927:Vmn2r120 UTSW 17 57509125 missense probably damaging 1.00
R5285:Vmn2r120 UTSW 17 57536703 missense probably damaging 1.00
R5566:Vmn2r120 UTSW 17 57545290 missense possibly damaging 0.95
R5578:Vmn2r120 UTSW 17 57522514 missense probably benign 0.01
R5643:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5644:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5781:Vmn2r120 UTSW 17 57524938 missense probably benign 0.00
R6084:Vmn2r120 UTSW 17 57525721 missense probably benign 0.15
R6120:Vmn2r120 UTSW 17 57525973 missense probably benign 0.02
R6160:Vmn2r120 UTSW 17 57509418 missense probably benign 0.03
R6256:Vmn2r120 UTSW 17 57524700 nonsense probably null
R6730:Vmn2r120 UTSW 17 57525012 missense probably benign 0.03
R6821:Vmn2r120 UTSW 17 57536659 missense probably benign 0.00
R6868:Vmn2r120 UTSW 17 57545218 missense probably benign 0.00
R6880:Vmn2r120 UTSW 17 57509187 missense probably damaging 1.00
R6986:Vmn2r120 UTSW 17 57509340 missense probably damaging 1.00
R7276:Vmn2r120 UTSW 17 57524881 missense probably benign 0.11
R7373:Vmn2r120 UTSW 17 57509406 missense probably benign 0.35
R7653:Vmn2r120 UTSW 17 57509258 missense possibly damaging 0.93
R7667:Vmn2r120 UTSW 17 57536657 missense probably benign 0.04
R7775:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7778:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7797:Vmn2r120 UTSW 17 57508874 missense probably damaging 1.00
R7824:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7902:Vmn2r120 UTSW 17 57509244 missense possibly damaging 0.87
R7922:Vmn2r120 UTSW 17 57524683 missense probably damaging 0.99
R8508:Vmn2r120 UTSW 17 57525843 missense probably benign 0.03
RF005:Vmn2r120 UTSW 17 57521991 missense possibly damaging 0.65
Z1177:Vmn2r120 UTSW 17 57509245 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAAGTGCGTTGATGGTACTTACTG -3'
(R):5'- ATTTCTCTTGGGGACTGCAG -3'

Sequencing Primer
(F):5'- CGTTGATGGTACTTACTGTTTCATAG -3'
(R):5'- TCTTGGGGACTGCAGCAAGG -3'
Posted On2018-02-28