Mutagenetix > Incidental Mutations

Incidental Mutation 'R6275:Mov10l1'

507602

Institutional Source

Beutler Lab

Gene Symbol

Mov10l1

Ensembl Gene

ENSMUSG00000015365

Gene Name

Moloney leukemia virus 10-like 1

Synonyms

Csm, CHAMP

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.184) question?

Stock #

R6275 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88982909-89055152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89026620 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1071 (I1071N)

Ref Sequence

ENSEMBL: ENSMUSP00000118437 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015509] [ENSMUST00000146993]

Predicted Effect

probably damaging
Transcript: ENSMUST00000015509
AA Change: I1019N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000015509
Gene: ENSMUSG00000015365
AA Change: I1019N

Domain	Start	End	E-Value	Type
low complexity region	52	65	N/A	INTRINSIC
low complexity region	338	349	N/A	INTRINSIC
Blast:AAA	444	526	2e-7	BLAST
internal_repeat_1	615	651	5.23e-10	PROSPERO
internal_repeat_1	648	696	5.23e-10	PROSPERO
Pfam:AAA_11	746	852	1.4e-17	PFAM
Pfam:AAA_30	746	933	5e-11	PFAM
Pfam:AAA_19	754	826	1.5e-10	PFAM
Pfam:AAA_11	855	928	1.3e-18	PFAM
Pfam:AAA_12	935	1152	3.7e-44	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000143030
AA Change: I141N

SMART Domains

Protein: ENSMUSP00000134200
Gene: ENSMUSG00000015365
AA Change: I141N

Domain	Start	End	E-Value	Type
Pfam:AAA_11	2	51	1e-14	PFAM
Pfam:AAA_12	58	275	5.2e-45	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000146993
AA Change: I1071N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118437
Gene: ENSMUSG00000015365
AA Change: I1071N

Domain	Start	End	E-Value	Type
low complexity region	104	117	N/A	INTRINSIC
low complexity region	390	401	N/A	INTRINSIC
Blast:AAA	496	578	2e-7	BLAST
internal_repeat_1	667	703	6.08e-10	PROSPERO
internal_repeat_1	700	748	6.08e-10	PROSPERO
Pfam:AAA_11	798	903	1e-15	PFAM
Pfam:AAA_30	798	985	1.8e-11	PFAM
Pfam:AAA_19	806	878	7e-11	PFAM
Pfam:AAA_11	907	980	3.2e-17	PFAM
Pfam:AAA_12	987	1204	1.4e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148198

Meta Mutation Damage Score

0.5711

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.4%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a putative RNA helicase and shows testis-specific expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a targeted allele lacking the helicase domain exhibit male infertility due to meiotic arrest, apoptosis, and derepression of retrotransposons in male germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,285,368	D3936G	probably damaging	Het
Abca7	T	A	10: 79,997,791	L30H	probably damaging	Het
Abcb6	T	C	1: 75,172,551		probably null	Het
Acsbg1	T	A	9: 54,609,772	M586L	probably benign	Het
Ano6	A	T	15: 95,913,433	Y159F	probably damaging	Het
C1ql1	A	G	11: 102,939,749	I254T	probably damaging	Het
Ccdc81	T	C	7: 89,882,311	D318G	possibly damaging	Het
Ccr7	C	T	11: 99,145,663	M144I	probably damaging	Het
Cdca3	C	T	6: 124,832,664		probably null	Het
Ces1h	A	T	8: 93,372,646	L93I	probably benign	Het
Cntfr	T	C	4: 41,663,216	D197G	possibly damaging	Het
Cyp2d12	C	A	15: 82,556,658	P126T	probably benign	Het
Dnah10	A	G	5: 124,785,184	T2225A	probably damaging	Het
Edrf1	A	T	7: 133,667,582	N1147Y	possibly damaging	Het
Ermap	C	T	4: 119,178,550	V414M	probably damaging	Het
Fam13a	A	G	6: 58,954,257	I446T	probably damaging	Het
Fgfbp3	T	C	19: 36,918,753	H155R	possibly damaging	Het
Folr1	T	A	7: 101,859,535	N61I	probably damaging	Het
Fsip1	T	C	2: 118,205,102	I431V	probably benign	Het
Gm5039	T	C	12: 88,321,225	D86G	possibly damaging	Het
Gm5493	A	T	17: 22,750,070	E74D	probably benign	Het
Gm6803	T	C	12: 88,018,485	N96S	probably benign	Het
H2-Oa	A	G	17: 34,094,566	D197G	probably benign	Het
Hps1	T	C	19: 42,769,607	E169G	probably null	Het
Il17rc	A	T	6: 113,480,347	M372L	probably benign	Het
Itga10	A	G	3: 96,658,185	S1042G	probably benign	Het
Jchain	A	T	5: 88,521,353	V147E	probably damaging	Het
Laptm4b	A	G	15: 34,283,327	T211A	probably benign	Het
Mal2	T	C	15: 54,571,639		probably null	Het
Mpp2	T	A	11: 102,060,969	Y401F	probably damaging	Het
Myh15	A	G	16: 49,145,247	T1172A	probably benign	Het
Olfr635	T	A	7: 103,979,974	S261T	probably damaging	Het
Pcnx	G	T	12: 81,918,607	S516I	probably benign	Het
Pidd1	C	T	7: 141,439,795	A685T	probably damaging	Het
Psg28	A	C	7: 18,430,440	Y116D	probably damaging	Het
Psmd11	T	C	11: 80,438,632		probably benign	Het
Rapgefl1	T	A	11: 98,851,120	Y637N	probably damaging	Het
Rbm25	T	A	12: 83,644,432	M66K	probably damaging	Het
Rnf38	T	A	4: 44,152,408	H52L	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGTGGCGGCGG	7: 97,579,923		probably benign	Het
Sec62	A	G	3: 30,809,836	Q89R	probably damaging	Het
Serpina6	T	A	12: 103,648,720	Q289L	probably benign	Het
Sf3b2	A	C	19: 5,283,650	I640S	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc26a11	T	C	11: 119,359,299	F127L	probably benign	Het
Stac3	T	A	10: 127,507,746	Y252*	probably null	Het
Stoml3	G	A	3: 53,507,506	A240T	probably damaging	Het
Tanc1	A	T	2: 59,843,510	H1653L	probably benign	Het
Tll1	A	T	8: 64,051,367	L665*	probably null	Het
Tnr	A	C	1: 159,861,270	Q434P	probably damaging	Het
Tpgs1	C	A	10: 79,675,520	D165E	probably benign	Het
Tsc2	A	G	17: 24,600,420	V1185A	probably benign	Het
Tulp4	A	G	17: 6,198,736	H203R	probably damaging	Het
Txnl4a	T	A	18: 80,218,765	M72K	possibly damaging	Het
Usp42	G	A	5: 143,714,972	R1099W	probably damaging	Het
Zfp292	G	A	4: 34,808,883	A1387V	possibly damaging	Het
Zfp994	A	T	17: 22,199,991	L659*	probably null	Het

Other mutations in Mov10l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Mov10l1	APN	15	88994989	missense	probably damaging	1.00
IGL01110:Mov10l1	APN	15	89021257	missense	probably benign	0.05
IGL01369:Mov10l1	APN	15	89024837	splice site	probably benign
IGL01531:Mov10l1	APN	15	89054352	missense	probably damaging	0.99
IGL01712:Mov10l1	APN	15	89024766	missense	probably damaging	0.98
IGL02330:Mov10l1	APN	15	89026490	missense	probably damaging	1.00
IGL02540:Mov10l1	APN	15	89018211	missense	probably benign
IGL02938:Mov10l1	APN	15	88988526	missense	probably damaging	1.00
R0382:Mov10l1	UTSW	15	88985593	missense	possibly damaging	0.96
R0437:Mov10l1	UTSW	15	89005312	missense	probably damaging	0.96
R0504:Mov10l1	UTSW	15	88998839	missense	probably damaging	1.00
R0538:Mov10l1	UTSW	15	88994860	missense	possibly damaging	0.73
R0577:Mov10l1	UTSW	15	89005727	missense	probably damaging	1.00
R0592:Mov10l1	UTSW	15	88998766	critical splice acceptor site	probably null
R0972:Mov10l1	UTSW	15	89021279	missense	probably damaging	0.99
R1386:Mov10l1	UTSW	15	89011386	missense	possibly damaging	0.87
R1737:Mov10l1	UTSW	15	89011404	missense	possibly damaging	0.79
R2120:Mov10l1	UTSW	15	89007627	missense	probably benign	0.30
R3740:Mov10l1	UTSW	15	89012142	missense	possibly damaging	0.92
R3741:Mov10l1	UTSW	15	89012142	missense	possibly damaging	0.92
R3846:Mov10l1	UTSW	15	89012142	missense	possibly damaging	0.92
R3850:Mov10l1	UTSW	15	89005695	critical splice acceptor site	probably null
R3964:Mov10l1	UTSW	15	89012163	missense	probably benign	0.00
R3965:Mov10l1	UTSW	15	89012163	missense	probably benign	0.00
R4049:Mov10l1	UTSW	15	88995032	splice site	probably benign
R4836:Mov10l1	UTSW	15	89020269	missense	possibly damaging	0.47
R5233:Mov10l1	UTSW	15	88983032	missense	probably benign
R5466:Mov10l1	UTSW	15	88985701	critical splice donor site	probably null
R5552:Mov10l1	UTSW	15	89054366	critical splice donor site	probably null
R5780:Mov10l1	UTSW	15	89011978	missense	probably benign
R6326:Mov10l1	UTSW	15	88994895	missense	probably damaging	1.00
R6652:Mov10l1	UTSW	15	88993902	missense	probably damaging	1.00
R6793:Mov10l1	UTSW	15	88996184	missense	possibly damaging	0.86
R7278:Mov10l1	UTSW	15	88993868	missense	probably benign	0.18
R7733:Mov10l1	UTSW	15	89024801	missense	probably damaging	0.99
R7998:Mov10l1	UTSW	15	89053439	missense	probably damaging	1.00
R8260:Mov10l1	UTSW	15	89012110	missense	probably benign
R8426:Mov10l1	UTSW	15	88997405	critical splice donor site	probably null
Z1177:Mov10l1	UTSW	15	88996136	missense	probably benign	0.36
Z1177:Mov10l1	UTSW	15	89018168	missense	probably damaging	0.99
Z1177:Mov10l1	UTSW	15	89053411	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTTTGACTCTGTGAGCCTATG -3'
(R):5'- AGAGATCAGCACCCGTCTTC -3'

Sequencing Primer
(F):5'- GACTCTGTGAGCCTATGCCTAC -3'
(R):5'- GTCTTCCCCACCCCCAGG -3'

Posted On

2018-03-15