Incidental Mutation 'R6275:Mov10l1'
ID507602
Institutional Source Beutler Lab
Gene Symbol Mov10l1
Ensembl Gene ENSMUSG00000015365
Gene NameMoloney leukemia virus 10-like 1
SynonymsCsm, CHAMP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6275 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location88982909-89055152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89026620 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1071 (I1071N)
Ref Sequence ENSEMBL: ENSMUSP00000118437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015509] [ENSMUST00000146993]
Predicted Effect probably damaging
Transcript: ENSMUST00000015509
AA Change: I1019N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015509
Gene: ENSMUSG00000015365
AA Change: I1019N

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
Blast:AAA 444 526 2e-7 BLAST
internal_repeat_1 615 651 5.23e-10 PROSPERO
internal_repeat_1 648 696 5.23e-10 PROSPERO
Pfam:AAA_11 746 852 1.4e-17 PFAM
Pfam:AAA_30 746 933 5e-11 PFAM
Pfam:AAA_19 754 826 1.5e-10 PFAM
Pfam:AAA_11 855 928 1.3e-18 PFAM
Pfam:AAA_12 935 1152 3.7e-44 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143030
AA Change: I141N
SMART Domains Protein: ENSMUSP00000134200
Gene: ENSMUSG00000015365
AA Change: I141N

DomainStartEndE-ValueType
Pfam:AAA_11 2 51 1e-14 PFAM
Pfam:AAA_12 58 275 5.2e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146993
AA Change: I1071N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118437
Gene: ENSMUSG00000015365
AA Change: I1071N

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
low complexity region 390 401 N/A INTRINSIC
Blast:AAA 496 578 2e-7 BLAST
internal_repeat_1 667 703 6.08e-10 PROSPERO
internal_repeat_1 700 748 6.08e-10 PROSPERO
Pfam:AAA_11 798 903 1e-15 PFAM
Pfam:AAA_30 798 985 1.8e-11 PFAM
Pfam:AAA_19 806 878 7e-11 PFAM
Pfam:AAA_11 907 980 3.2e-17 PFAM
Pfam:AAA_12 987 1204 1.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148198
Meta Mutation Damage Score 0.5711 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a putative RNA helicase and shows testis-specific expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a targeted allele lacking the helicase domain exhibit male infertility due to meiotic arrest, apoptosis, and derepression of retrotransposons in male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Mov10l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Mov10l1 APN 15 88994989 missense probably damaging 1.00
IGL01110:Mov10l1 APN 15 89021257 missense probably benign 0.05
IGL01369:Mov10l1 APN 15 89024837 splice site probably benign
IGL01531:Mov10l1 APN 15 89054352 missense probably damaging 0.99
IGL01712:Mov10l1 APN 15 89024766 missense probably damaging 0.98
IGL02330:Mov10l1 APN 15 89026490 missense probably damaging 1.00
IGL02540:Mov10l1 APN 15 89018211 missense probably benign
IGL02938:Mov10l1 APN 15 88988526 missense probably damaging 1.00
R0382:Mov10l1 UTSW 15 88985593 missense possibly damaging 0.96
R0437:Mov10l1 UTSW 15 89005312 missense probably damaging 0.96
R0504:Mov10l1 UTSW 15 88998839 missense probably damaging 1.00
R0538:Mov10l1 UTSW 15 88994860 missense possibly damaging 0.73
R0577:Mov10l1 UTSW 15 89005727 missense probably damaging 1.00
R0592:Mov10l1 UTSW 15 88998766 critical splice acceptor site probably null
R0972:Mov10l1 UTSW 15 89021279 missense probably damaging 0.99
R1386:Mov10l1 UTSW 15 89011386 missense possibly damaging 0.87
R1737:Mov10l1 UTSW 15 89011404 missense possibly damaging 0.79
R2120:Mov10l1 UTSW 15 89007627 missense probably benign 0.30
R3740:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3741:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3846:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3850:Mov10l1 UTSW 15 89005695 critical splice acceptor site probably null
R3964:Mov10l1 UTSW 15 89012163 missense probably benign 0.00
R3965:Mov10l1 UTSW 15 89012163 missense probably benign 0.00
R4049:Mov10l1 UTSW 15 88995032 splice site probably benign
R4836:Mov10l1 UTSW 15 89020269 missense possibly damaging 0.47
R5233:Mov10l1 UTSW 15 88983032 missense probably benign
R5466:Mov10l1 UTSW 15 88985701 critical splice donor site probably null
R5552:Mov10l1 UTSW 15 89054366 critical splice donor site probably null
R5780:Mov10l1 UTSW 15 89011978 missense probably benign
R6326:Mov10l1 UTSW 15 88994895 missense probably damaging 1.00
R6652:Mov10l1 UTSW 15 88993902 missense probably damaging 1.00
R6793:Mov10l1 UTSW 15 88996184 missense possibly damaging 0.86
R7278:Mov10l1 UTSW 15 88993868 missense probably benign 0.18
R7733:Mov10l1 UTSW 15 89024801 missense probably damaging 0.99
R7998:Mov10l1 UTSW 15 89053439 missense probably damaging 1.00
R8260:Mov10l1 UTSW 15 89012110 missense probably benign
R8426:Mov10l1 UTSW 15 88997405 critical splice donor site probably null
Z1177:Mov10l1 UTSW 15 88996136 missense probably benign 0.36
Z1177:Mov10l1 UTSW 15 89018168 missense probably damaging 0.99
Z1177:Mov10l1 UTSW 15 89053411 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTTGACTCTGTGAGCCTATG -3'
(R):5'- AGAGATCAGCACCCGTCTTC -3'

Sequencing Primer
(F):5'- GACTCTGTGAGCCTATGCCTAC -3'
(R):5'- GTCTTCCCCACCCCCAGG -3'
Posted On2018-03-15