Incidental Mutation 'R6275:Tll1'
ID 507582
Institutional Source Beutler Lab
Gene Symbol Tll1
Ensembl Gene ENSMUSG00000053626
Gene Name tolloid-like
Synonyms Tll-1, b2b2476Clo
MMRRC Submission 044445-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6275 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 64467965-64659305 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 64504401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 665 (L665*)
Ref Sequence ENSEMBL: ENSMUSP00000070560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066166]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000066166
AA Change: L665*
SMART Domains Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: L665*

DomainStartEndE-ValueType
ZnMc 153 295 4.12e-56 SMART
CUB 349 461 4.12e-44 SMART
CUB 462 574 3.81e-48 SMART
EGF_CA 574 615 2.28e-9 SMART
CUB 618 730 9.11e-46 SMART
EGF_CA 730 770 4.25e-9 SMART
CUB 774 886 2.01e-47 SMART
CUB 887 1003 7.19e-35 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,833,625 (GRCm39) L30H probably damaging Het
Abcb6 T C 1: 75,149,195 (GRCm39) probably null Het
Acsbg1 T A 9: 54,517,056 (GRCm39) M586L probably benign Het
Ano6 A T 15: 95,811,314 (GRCm39) Y159F probably damaging Het
C1ql1 A G 11: 102,830,575 (GRCm39) I254T probably damaging Het
Ccdc81 T C 7: 89,531,519 (GRCm39) D318G possibly damaging Het
Ccr7 C T 11: 99,036,489 (GRCm39) M144I probably damaging Het
Cdca3 C T 6: 124,809,627 (GRCm39) probably null Het
Ces1h A T 8: 94,099,274 (GRCm39) L93I probably benign Het
Cntfr T C 4: 41,663,216 (GRCm39) D197G possibly damaging Het
Cyp2d12 C A 15: 82,440,859 (GRCm39) P126T probably benign Het
Dnah10 A G 5: 124,862,248 (GRCm39) T2225A probably damaging Het
Edrf1 A T 7: 133,269,311 (GRCm39) N1147Y possibly damaging Het
Eif1ad15 T C 12: 88,287,995 (GRCm39) D86G possibly damaging Het
Eif1ad16 T C 12: 87,985,255 (GRCm39) N96S probably benign Het
Ermap C T 4: 119,035,747 (GRCm39) V414M probably damaging Het
Fam13a A G 6: 58,931,242 (GRCm39) I446T probably damaging Het
Fgfbp3 T C 19: 36,896,153 (GRCm39) H155R possibly damaging Het
Folr1 T A 7: 101,508,742 (GRCm39) N61I probably damaging Het
Fsip1 T C 2: 118,035,583 (GRCm39) I431V probably benign Het
Gm5493 A T 17: 22,969,043 (GRCm39) E74D probably benign Het
H2-Oa A G 17: 34,313,540 (GRCm39) D197G probably benign Het
Hps1 T C 19: 42,758,046 (GRCm39) E169G probably null Het
Il17rc A T 6: 113,457,308 (GRCm39) M372L probably benign Het
Itga10 A G 3: 96,565,501 (GRCm39) S1042G probably benign Het
Jchain A T 5: 88,669,212 (GRCm39) V147E probably damaging Het
Laptm4b A G 15: 34,283,473 (GRCm39) T211A probably benign Het
Mal2 T C 15: 54,435,035 (GRCm39) probably null Het
Mov10l1 T A 15: 88,910,823 (GRCm39) I1071N probably damaging Het
Mpp2 T A 11: 101,951,795 (GRCm39) Y401F probably damaging Het
Myh15 A G 16: 48,965,610 (GRCm39) T1172A probably benign Het
Or51q1 T A 7: 103,629,181 (GRCm39) S261T probably damaging Het
Pcnx1 G T 12: 81,965,381 (GRCm39) S516I probably benign Het
Pidd1 C T 7: 141,019,708 (GRCm39) A685T probably damaging Het
Psg28 A C 7: 18,164,365 (GRCm39) Y116D probably damaging Het
Psmd11 T C 11: 80,329,458 (GRCm39) probably benign Het
Rapgefl1 T A 11: 98,741,946 (GRCm39) Y637N probably damaging Het
Rbm25 T A 12: 83,691,206 (GRCm39) M66K probably damaging Het
Rnf38 T A 4: 44,152,408 (GRCm39) H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,229,130 (GRCm39) probably benign Het
Sec62 A G 3: 30,863,985 (GRCm39) Q89R probably damaging Het
Serpina6 T A 12: 103,614,979 (GRCm39) Q289L probably benign Het
Sf3b2 A C 19: 5,333,678 (GRCm39) I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,294,306 (GRCm39) probably benign Het
Slc26a11 T C 11: 119,250,125 (GRCm39) F127L probably benign Het
Spata31h1 T C 10: 82,121,202 (GRCm39) D3936G probably damaging Het
Stac3 T A 10: 127,343,615 (GRCm39) Y252* probably null Het
Stoml3 G A 3: 53,414,927 (GRCm39) A240T probably damaging Het
Tanc1 A T 2: 59,673,854 (GRCm39) H1653L probably benign Het
Tnr A C 1: 159,688,840 (GRCm39) Q434P probably damaging Het
Tpgs1 C A 10: 79,511,354 (GRCm39) D165E probably benign Het
Tsc2 A G 17: 24,819,394 (GRCm39) V1185A probably benign Het
Tulp4 A G 17: 6,249,011 (GRCm39) H203R probably damaging Het
Txnl4a T A 18: 80,261,980 (GRCm39) M72K possibly damaging Het
Usp42 G A 5: 143,700,727 (GRCm39) R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 (GRCm39) A1387V possibly damaging Het
Zfp994 A T 17: 22,418,972 (GRCm39) L659* probably null Het
Other mutations in Tll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tll1 APN 8 64,469,170 (GRCm39) missense probably benign
IGL00583:Tll1 APN 8 64,658,326 (GRCm39) missense probably benign
IGL00767:Tll1 APN 8 64,524,355 (GRCm39) missense probably damaging 1.00
IGL01061:Tll1 APN 8 64,491,488 (GRCm39) critical splice donor site probably null
IGL01077:Tll1 APN 8 64,523,266 (GRCm39) missense probably benign 0.27
IGL01536:Tll1 APN 8 64,527,323 (GRCm39) missense probably damaging 1.00
IGL02137:Tll1 APN 8 64,469,132 (GRCm39) missense possibly damaging 0.73
IGL02168:Tll1 APN 8 64,507,001 (GRCm39) missense possibly damaging 0.50
IGL02378:Tll1 APN 8 64,470,660 (GRCm39) nonsense probably null
IGL02469:Tll1 APN 8 64,523,314 (GRCm39) missense probably benign 0.41
IGL02504:Tll1 APN 8 64,523,271 (GRCm39) missense possibly damaging 0.55
IGL02650:Tll1 APN 8 64,500,031 (GRCm39) splice site probably benign
IGL02937:Tll1 APN 8 64,658,319 (GRCm39) nonsense probably null
IGL03006:Tll1 APN 8 64,527,251 (GRCm39) splice site probably benign
R0518:Tll1 UTSW 8 64,551,505 (GRCm39) missense probably damaging 1.00
R0521:Tll1 UTSW 8 64,551,505 (GRCm39) missense probably damaging 1.00
R0541:Tll1 UTSW 8 64,491,486 (GRCm39) splice site probably null
R0612:Tll1 UTSW 8 64,524,344 (GRCm39) missense possibly damaging 0.91
R0690:Tll1 UTSW 8 64,527,324 (GRCm39) missense probably damaging 0.99
R0738:Tll1 UTSW 8 64,554,984 (GRCm39) missense probably damaging 1.00
R1454:Tll1 UTSW 8 64,491,524 (GRCm39) missense probably benign
R1619:Tll1 UTSW 8 64,509,307 (GRCm39) missense probably benign 0.25
R1625:Tll1 UTSW 8 64,494,476 (GRCm39) missense probably damaging 1.00
R1654:Tll1 UTSW 8 64,570,937 (GRCm39) critical splice donor site probably null
R1663:Tll1 UTSW 8 64,470,720 (GRCm39) missense probably benign 0.08
R1681:Tll1 UTSW 8 64,538,585 (GRCm39) missense possibly damaging 0.93
R1713:Tll1 UTSW 8 64,554,907 (GRCm39) missense probably damaging 0.99
R1908:Tll1 UTSW 8 64,478,141 (GRCm39) missense probably damaging 0.98
R2118:Tll1 UTSW 8 64,538,591 (GRCm39) missense probably benign 0.21
R2121:Tll1 UTSW 8 64,538,591 (GRCm39) missense probably benign 0.21
R2124:Tll1 UTSW 8 64,538,591 (GRCm39) missense probably benign 0.21
R2360:Tll1 UTSW 8 64,504,435 (GRCm39) missense probably damaging 1.00
R2396:Tll1 UTSW 8 64,523,324 (GRCm39) nonsense probably null
R3032:Tll1 UTSW 8 64,551,526 (GRCm39) missense probably damaging 0.96
R3115:Tll1 UTSW 8 64,506,900 (GRCm39) missense probably damaging 1.00
R3889:Tll1 UTSW 8 64,658,258 (GRCm39) missense possibly damaging 0.77
R4126:Tll1 UTSW 8 64,571,048 (GRCm39) missense possibly damaging 0.78
R4182:Tll1 UTSW 8 64,494,545 (GRCm39) missense probably damaging 1.00
R4572:Tll1 UTSW 8 64,509,343 (GRCm39) missense possibly damaging 0.81
R4677:Tll1 UTSW 8 64,504,411 (GRCm39) missense probably benign 0.31
R4811:Tll1 UTSW 8 64,538,507 (GRCm39) missense possibly damaging 0.72
R4904:Tll1 UTSW 8 64,523,233 (GRCm39) missense probably benign 0.00
R4992:Tll1 UTSW 8 64,546,978 (GRCm39) missense probably damaging 0.98
R5061:Tll1 UTSW 8 64,506,983 (GRCm39) missense probably damaging 0.99
R5078:Tll1 UTSW 8 64,546,921 (GRCm39) missense probably damaging 1.00
R5208:Tll1 UTSW 8 64,504,527 (GRCm39) missense probably damaging 0.99
R5283:Tll1 UTSW 8 64,555,000 (GRCm39) missense possibly damaging 0.68
R5399:Tll1 UTSW 8 64,538,522 (GRCm39) missense probably damaging 1.00
R5699:Tll1 UTSW 8 64,570,974 (GRCm39) missense probably damaging 0.98
R5986:Tll1 UTSW 8 64,527,297 (GRCm39) missense probably damaging 0.99
R6019:Tll1 UTSW 8 64,494,525 (GRCm39) missense possibly damaging 0.83
R6046:Tll1 UTSW 8 64,506,925 (GRCm39) nonsense probably null
R6083:Tll1 UTSW 8 64,491,620 (GRCm39) splice site probably null
R6125:Tll1 UTSW 8 64,504,521 (GRCm39) missense probably damaging 1.00
R6222:Tll1 UTSW 8 64,551,568 (GRCm39) missense probably benign 0.18
R6508:Tll1 UTSW 8 64,551,494 (GRCm39) missense probably damaging 0.99
R6758:Tll1 UTSW 8 64,494,439 (GRCm39) critical splice donor site probably null
R6782:Tll1 UTSW 8 64,524,315 (GRCm39) missense probably benign 0.00
R6848:Tll1 UTSW 8 64,551,544 (GRCm39) missense probably damaging 0.99
R7057:Tll1 UTSW 8 64,554,915 (GRCm39) missense probably damaging 1.00
R7144:Tll1 UTSW 8 64,577,979 (GRCm39) missense possibly damaging 0.90
R7244:Tll1 UTSW 8 64,478,222 (GRCm39) missense probably benign 0.00
R7336:Tll1 UTSW 8 64,478,176 (GRCm39) missense probably damaging 0.98
R7373:Tll1 UTSW 8 64,504,391 (GRCm39) missense probably damaging 0.98
R7626:Tll1 UTSW 8 64,551,268 (GRCm39) splice site probably null
R7687:Tll1 UTSW 8 64,574,526 (GRCm39) nonsense probably null
R7699:Tll1 UTSW 8 64,546,988 (GRCm39) missense probably benign 0.00
R7700:Tll1 UTSW 8 64,546,988 (GRCm39) missense probably benign 0.00
R7765:Tll1 UTSW 8 64,504,483 (GRCm39) missense probably damaging 1.00
R7790:Tll1 UTSW 8 64,478,271 (GRCm39) nonsense probably null
R7954:Tll1 UTSW 8 64,571,568 (GRCm39) missense probably damaging 1.00
R8710:Tll1 UTSW 8 64,577,940 (GRCm39) missense possibly damaging 0.77
R8792:Tll1 UTSW 8 64,538,499 (GRCm39) missense probably damaging 1.00
R9134:Tll1 UTSW 8 64,469,201 (GRCm39) missense possibly damaging 0.91
R9444:Tll1 UTSW 8 64,469,123 (GRCm39) missense probably damaging 1.00
R9539:Tll1 UTSW 8 64,494,457 (GRCm39) missense probably damaging 1.00
X0020:Tll1 UTSW 8 64,470,662 (GRCm39) missense probably damaging 0.97
Z1176:Tll1 UTSW 8 64,500,197 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGACCAGAAAGTACTTGCAG -3'
(R):5'- TTCACATTAAATGCAGAGATGGCG -3'

Sequencing Primer
(F):5'- CCAGAAAGTACTTGCAGAAAGGAGC -3'
(R):5'- CGGAGCATCTTTGTTAAGGAGCTC -3'
Posted On 2018-03-15