Incidental Mutation 'R6321:Pnpla6'
ID 510349
Institutional Source Beutler Lab
Gene Symbol Pnpla6
Ensembl Gene ENSMUSG00000004565
Gene Name patatin-like phospholipase domain containing 6
Synonyms Nte, Swiss-cheese, MSws
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6321 (G1)
Quality Score 210.009
Status Validated
Chromosome 8
Chromosomal Location 3515384-3544267 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3544015 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1342 (V1342A)
Ref Sequence ENSEMBL: ENSMUSP00000146680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000111070] [ENSMUST00000207421] [ENSMUST00000207941] [ENSMUST00000208002]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000004681
AA Change: V1324A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: V1324A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111070
AA Change: V1324A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: V1324A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207317
Predicted Effect probably benign
Transcript: ENSMUST00000207336
Predicted Effect probably benign
Transcript: ENSMUST00000207421
Predicted Effect probably benign
Transcript: ENSMUST00000207941
AA Change: V1313A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208002
AA Change: V1342A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208851
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Pnpla6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pnpla6 APN 8 3523808 missense probably damaging 1.00
IGL00820:Pnpla6 APN 8 3532358 missense possibly damaging 0.95
IGL00839:Pnpla6 APN 8 3542299 missense probably benign 0.05
IGL01732:Pnpla6 APN 8 3522616 missense probably damaging 0.99
IGL01973:Pnpla6 APN 8 3517619 missense probably damaging 1.00
IGL02267:Pnpla6 APN 8 3517327 missense probably benign 0.00
IGL03246:Pnpla6 APN 8 3531530 missense probably benign 0.01
IGL03286:Pnpla6 APN 8 3531473 missense probably damaging 0.99
Immemorial UTSW 8 3531677 missense probably benign 0.38
Mammilary UTSW 8 3521384 missense probably benign 0.01
I0000:Pnpla6 UTSW 8 3542322 missense probably benign
R0141:Pnpla6 UTSW 8 3532117 critical splice donor site probably null
R0180:Pnpla6 UTSW 8 3524250 critical splice acceptor site probably null
R0377:Pnpla6 UTSW 8 3541501 missense probably damaging 1.00
R0563:Pnpla6 UTSW 8 3523333 missense possibly damaging 0.51
R0660:Pnpla6 UTSW 8 3522269 unclassified probably benign
R0786:Pnpla6 UTSW 8 3523317 missense probably benign
R0827:Pnpla6 UTSW 8 3517618 missense possibly damaging 0.71
R0882:Pnpla6 UTSW 8 3517081 missense probably damaging 1.00
R1512:Pnpla6 UTSW 8 3535459 splice site probably benign
R1552:Pnpla6 UTSW 8 3522403 missense probably damaging 1.00
R1609:Pnpla6 UTSW 8 3517135 missense probably damaging 1.00
R1770:Pnpla6 UTSW 8 3534634 missense possibly damaging 0.94
R1779:Pnpla6 UTSW 8 3541404 missense probably damaging 1.00
R1987:Pnpla6 UTSW 8 3542370 missense probably benign 0.00
R3079:Pnpla6 UTSW 8 3541512 missense probably benign 0.25
R3125:Pnpla6 UTSW 8 3534670 missense probably null 1.00
R4171:Pnpla6 UTSW 8 3543997 missense probably benign 0.09
R4281:Pnpla6 UTSW 8 3521513 missense probably damaging 1.00
R4674:Pnpla6 UTSW 8 3521412 missense probably damaging 1.00
R4776:Pnpla6 UTSW 8 3523818 missense probably benign 0.01
R4779:Pnpla6 UTSW 8 3522838 missense probably benign 0.00
R5114:Pnpla6 UTSW 8 3522613 missense probably damaging 0.98
R5459:Pnpla6 UTSW 8 3535829 missense probably benign 0.01
R5510:Pnpla6 UTSW 8 3521397 missense probably damaging 0.99
R5538:Pnpla6 UTSW 8 3531508 missense probably benign 0.01
R5664:Pnpla6 UTSW 8 3537478 missense probably damaging 0.98
R6063:Pnpla6 UTSW 8 3524156 missense probably benign 0.21
R6314:Pnpla6 UTSW 8 3521572 missense probably benign 0.39
R6454:Pnpla6 UTSW 8 3537986 missense probably damaging 0.99
R6477:Pnpla6 UTSW 8 3536627 missense probably benign 0.00
R6524:Pnpla6 UTSW 8 3534519 splice site probably null
R6809:Pnpla6 UTSW 8 3534611 missense possibly damaging 0.72
R6975:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7293:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7389:Pnpla6 UTSW 8 3543981 nonsense probably null
R7426:Pnpla6 UTSW 8 3516540 splice site probably null
R7520:Pnpla6 UTSW 8 3537508 missense probably damaging 1.00
R7666:Pnpla6 UTSW 8 3541591 missense probably benign 0.01
R7733:Pnpla6 UTSW 8 3522660 missense probably benign 0.01
R7743:Pnpla6 UTSW 8 3536594 missense possibly damaging 0.77
R7744:Pnpla6 UTSW 8 3531677 missense probably benign 0.38
R7923:Pnpla6 UTSW 8 3531737 nonsense probably null
R7980:Pnpla6 UTSW 8 3536562 missense probably damaging 0.97
R8141:Pnpla6 UTSW 8 3521384 missense probably benign 0.01
R8191:Pnpla6 UTSW 8 3542382 missense probably benign 0.12
R8251:Pnpla6 UTSW 8 3532399 missense probably benign 0.29
R8881:Pnpla6 UTSW 8 3531489 missense probably benign 0.00
R8917:Pnpla6 UTSW 8 3517637 missense possibly damaging 0.50
R8939:Pnpla6 UTSW 8 3521319 missense possibly damaging 0.86
R8988:Pnpla6 UTSW 8 3517401 missense possibly damaging 0.51
R9037:Pnpla6 UTSW 8 3542379 nonsense probably null
R9264:Pnpla6 UTSW 8 3523294 missense probably benign
R9265:Pnpla6 UTSW 8 3523294 missense probably benign
R9386:Pnpla6 UTSW 8 3521417 critical splice donor site probably null
X0018:Pnpla6 UTSW 8 3517337 missense probably damaging 1.00
Z1177:Pnpla6 UTSW 8 3536979 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGTGACATTTATCAAGCAAGGC -3'
(R):5'- GGTTATCAGTGCAGTTCTGCC -3'

Sequencing Primer
(F):5'- AGGCTTGAGATGAAACTAGTTTTGAG -3'
(R):5'- AGTGCAGTTCTGCCCTCCC -3'
Posted On 2018-04-02