Mutagenetix > Incidental Mutations

Incidental Mutation 'R6388:Npc1l1'

515639

Institutional Source

Beutler Lab

Gene Symbol

Npc1l1

Ensembl Gene

ENSMUSG00000020447

Gene Name

NPC1 like intracellular cholesterol transporter 1

Synonyms

9130221N23Rik, Niemann-Pick disease, type C1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R6388 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6211013-6230143 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 6224145 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 720 (E720G)

Ref Sequence

ENSEMBL: ENSMUSP00000004505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004505]

Predicted Effect

probably damaging
Transcript: ENSMUST00000004505
AA Change: E720G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: E720G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:NPC1_N	28	283	8.7e-74	PFAM
low complexity region	294	307	N/A	INTRINSIC
transmembrane domain	348	370	N/A	INTRINSIC
Pfam:Patched	385	897	4.7e-52	PFAM
Pfam:Sterol-sensing	661	815	5.7e-55	PFAM
Pfam:MMPL	665	830	2.3e-11	PFAM
Pfam:Patched	1063	1268	6.2e-34	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.8%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,262,111	R560W	probably benign	Het
Abi3	A	G	11: 95,833,638		probably null	Het
Ap1b1	T	C	11: 5,026,319	I449T	probably damaging	Het
Atpaf2	C	A	11: 60,417,007		probably benign	Het
Car5a	T	C	8: 121,927,171	Y118C	probably damaging	Het
Ccdc18	A	G	5: 108,201,348	D1002G	possibly damaging	Het
Ciao1	A	T	2: 127,246,476	C142*	probably null	Het
Clec14a	A	G	12: 58,267,457	*460R	probably null	Het
Defb30	T	A	14: 63,049,764		probably benign	Het
Dnah10	A	G	5: 124,829,646	K4247R	probably benign	Het
Eif5b	G	A	1: 38,019,000	A128T	unknown	Het
Fam3b	T	C	16: 97,478,391	T113A	probably benign	Het
Fam98c	C	T	7: 29,155,303	R126Q	probably damaging	Het
Fastkd3	C	T	13: 68,590,200	L623F	probably damaging	Het
Golga1	T	C	2: 39,023,171	D543G	probably benign	Het
Gpatch8	A	T	11: 102,478,488	V1408E	probably damaging	Het
Icosl	T	A	10: 78,069,532	L3Q	possibly damaging	Homo
Igf2r	A	G	17: 12,683,900	V2421A	probably benign	Het
Iglon5	T	C	7: 43,478,132	T165A	possibly damaging	Het
Map3k11	A	G	19: 5,690,251	E2G	probably damaging	Het
Nipbl	A	T	15: 8,300,784	C2386S	probably damaging	Het
Nos1	A	G	5: 117,914,436	E837G	possibly damaging	Het
Olfr395	A	G	11: 73,907,292	S67P	probably damaging	Het
Pla1a	T	A	16: 38,397,472	M385L	probably benign	Het
Ppp1r32	A	G	19: 10,482,301	V14A	probably damaging	Het
Setdb2	T	C	14: 59,424,697	T82A	probably benign	Het
Smarcd3	A	G	5: 24,596,026	F128L	possibly damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Syvn1	T	A	19: 6,052,351	V483E	probably damaging	Het
Timm22	G	A	11: 76,407,119	V19I	probably benign	Het
Ttn	C	A	2: 76,790,845	D15716Y	probably damaging	Het
Ube3a	C	T	7: 59,304,921		probably null	Het
Ugp2	A	G	11: 21,322,051		probably null	Het
Vmn1r13	T	A	6: 57,209,918	F21I	probably benign	Het
Vps13d	T	C	4: 145,155,574	S1150G	probably benign	Het
Zp3	T	C	5: 135,982,694	V122A	probably benign	Het

Other mutations in Npc1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Npc1l1	APN	11	6224199	missense	probably damaging	1.00
IGL01348:Npc1l1	APN	11	6227974	missense	probably damaging	1.00
IGL01891:Npc1l1	APN	11	6214280	missense	probably damaging	1.00
IGL01897:Npc1l1	APN	11	6227879	missense	probably benign
IGL02098:Npc1l1	APN	11	6214581	missense	probably damaging	0.99
IGL02121:Npc1l1	APN	11	6228157	missense	probably benign
IGL02724:Npc1l1	APN	11	6214684	missense	possibly damaging	0.88
IGL02947:Npc1l1	APN	11	6229246	missense	probably benign	0.01
IGL03328:Npc1l1	APN	11	6218643	nonsense	probably null
R0137:Npc1l1	UTSW	11	6228148	nonsense	probably null
R0322:Npc1l1	UTSW	11	6229042	missense	probably benign
R0352:Npc1l1	UTSW	11	6223076	missense	probably benign	0.00
R0492:Npc1l1	UTSW	11	6223040	missense	possibly damaging	0.82
R0918:Npc1l1	UTSW	11	6218239	missense	probably damaging	1.00
R1300:Npc1l1	UTSW	11	6227859	missense	probably damaging	1.00
R1455:Npc1l1	UTSW	11	6228174	missense	possibly damaging	0.66
R1588:Npc1l1	UTSW	11	6217785	missense	probably benign	0.01
R1803:Npc1l1	UTSW	11	6228846	missense	probably damaging	1.00
R1882:Npc1l1	UTSW	11	6217473	splice site	probably null
R1944:Npc1l1	UTSW	11	6214588	missense	possibly damaging	0.67
R1945:Npc1l1	UTSW	11	6214588	missense	possibly damaging	0.67
R1945:Npc1l1	UTSW	11	6225199	nonsense	probably null
R3155:Npc1l1	UTSW	11	6221840	missense	probably benign
R4343:Npc1l1	UTSW	11	6217773	missense	probably benign
R4504:Npc1l1	UTSW	11	6228741	missense	possibly damaging	0.61
R4610:Npc1l1	UTSW	11	6228215	missense	probably damaging	1.00
R4807:Npc1l1	UTSW	11	6218723	missense	probably damaging	1.00
R4829:Npc1l1	UTSW	11	6214010	critical splice donor site	probably null
R5135:Npc1l1	UTSW	11	6224245	missense	possibly damaging	0.94
R5290:Npc1l1	UTSW	11	6222221	missense	probably benign	0.00
R5369:Npc1l1	UTSW	11	6217705	critical splice donor site	probably null
R5388:Npc1l1	UTSW	11	6214733	missense	probably damaging	1.00
R5532:Npc1l1	UTSW	11	6224245	missense	probably damaging	0.98
R5540:Npc1l1	UTSW	11	6214546	missense	probably damaging	1.00
R5754:Npc1l1	UTSW	11	6227839	missense	probably damaging	1.00
R5760:Npc1l1	UTSW	11	6229031	missense	probably benign	0.02
R6057:Npc1l1	UTSW	11	6217806	missense	possibly damaging	0.66
R6644:Npc1l1	UTSW	11	6214013	missense	probably damaging	1.00
R6644:Npc1l1	UTSW	11	6214014	missense	probably damaging	0.98
R6756:Npc1l1	UTSW	11	6215153	missense	probably damaging	1.00
R6790:Npc1l1	UTSW	11	6214260	splice site	probably null
R7006:Npc1l1	UTSW	11	6217731	missense	probably benign
R7062:Npc1l1	UTSW	11	6217807	missense	probably benign
R7273:Npc1l1	UTSW	11	6218320	missense	probably damaging	1.00
R7383:Npc1l1	UTSW	11	6217777	missense	probably benign	0.30
R8003:Npc1l1	UTSW	11	6215129	missense	probably benign	0.01
R8081:Npc1l1	UTSW	11	6217768	missense	probably benign	0.01
R8272:Npc1l1	UTSW	11	6229327	nonsense	probably null
X0022:Npc1l1	UTSW	11	6228058	missense	probably damaging	1.00
Z1177:Npc1l1	UTSW	11	6214343	missense	probably damaging	1.00
Z1177:Npc1l1	UTSW	11	6218681	missense	probably damaging	0.99
Z1177:Npc1l1	UTSW	11	6225209	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CGCCCCTGGTAATGTAAAGG -3'
(R):5'- TGGATTCCAAGGCTACTCTGG -3'

Sequencing Primer
(F):5'- CCATTACAAAGCTTACTGGATGCTG -3'
(R):5'- AAGGCTACTCTGGGCCTAG -3'

Posted On

2018-05-04