Incidental Mutation 'R6388:Npc1l1'
ID515639
Institutional Source Beutler Lab
Gene Symbol Npc1l1
Ensembl Gene ENSMUSG00000020447
Gene NameNPC1 like intracellular cholesterol transporter 1
Synonyms9130221N23Rik, Niemann-Pick disease, type C1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location6211013-6230143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6224145 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 720 (E720G)
Ref Sequence ENSEMBL: ENSMUSP00000004505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004505]
Predicted Effect probably damaging
Transcript: ENSMUST00000004505
AA Change: E720G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: E720G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NPC1_N 28 283 8.7e-74 PFAM
low complexity region 294 307 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:Patched 385 897 4.7e-52 PFAM
Pfam:Sterol-sensing 661 815 5.7e-55 PFAM
Pfam:MMPL 665 830 2.3e-11 PFAM
Pfam:Patched 1063 1268 6.2e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Npc1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Npc1l1 APN 11 6224199 missense probably damaging 1.00
IGL01348:Npc1l1 APN 11 6227974 missense probably damaging 1.00
IGL01891:Npc1l1 APN 11 6214280 missense probably damaging 1.00
IGL01897:Npc1l1 APN 11 6227879 missense probably benign
IGL02098:Npc1l1 APN 11 6214581 missense probably damaging 0.99
IGL02121:Npc1l1 APN 11 6228157 missense probably benign
IGL02724:Npc1l1 APN 11 6214684 missense possibly damaging 0.88
IGL02947:Npc1l1 APN 11 6229246 missense probably benign 0.01
IGL03328:Npc1l1 APN 11 6218643 nonsense probably null
R0137:Npc1l1 UTSW 11 6228148 nonsense probably null
R0322:Npc1l1 UTSW 11 6229042 missense probably benign
R0352:Npc1l1 UTSW 11 6223076 missense probably benign 0.00
R0492:Npc1l1 UTSW 11 6223040 missense possibly damaging 0.82
R0918:Npc1l1 UTSW 11 6218239 missense probably damaging 1.00
R1300:Npc1l1 UTSW 11 6227859 missense probably damaging 1.00
R1455:Npc1l1 UTSW 11 6228174 missense possibly damaging 0.66
R1588:Npc1l1 UTSW 11 6217785 missense probably benign 0.01
R1803:Npc1l1 UTSW 11 6228846 missense probably damaging 1.00
R1882:Npc1l1 UTSW 11 6217473 splice site probably null
R1944:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6225199 nonsense probably null
R3155:Npc1l1 UTSW 11 6221840 missense probably benign
R4343:Npc1l1 UTSW 11 6217773 missense probably benign
R4504:Npc1l1 UTSW 11 6228741 missense possibly damaging 0.61
R4610:Npc1l1 UTSW 11 6228215 missense probably damaging 1.00
R4807:Npc1l1 UTSW 11 6218723 missense probably damaging 1.00
R4829:Npc1l1 UTSW 11 6214010 critical splice donor site probably null
R5135:Npc1l1 UTSW 11 6224245 missense possibly damaging 0.94
R5290:Npc1l1 UTSW 11 6222221 missense probably benign 0.00
R5369:Npc1l1 UTSW 11 6217705 critical splice donor site probably null
R5388:Npc1l1 UTSW 11 6214733 missense probably damaging 1.00
R5532:Npc1l1 UTSW 11 6224245 missense probably damaging 0.98
R5540:Npc1l1 UTSW 11 6214546 missense probably damaging 1.00
R5754:Npc1l1 UTSW 11 6227839 missense probably damaging 1.00
R5760:Npc1l1 UTSW 11 6229031 missense probably benign 0.02
R6057:Npc1l1 UTSW 11 6217806 missense possibly damaging 0.66
R6644:Npc1l1 UTSW 11 6214013 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214014 missense probably damaging 0.98
R6756:Npc1l1 UTSW 11 6215153 missense probably damaging 1.00
R6790:Npc1l1 UTSW 11 6214260 splice site probably null
R7006:Npc1l1 UTSW 11 6217731 missense probably benign
R7062:Npc1l1 UTSW 11 6217807 missense probably benign
R7273:Npc1l1 UTSW 11 6218320 missense probably damaging 1.00
R7383:Npc1l1 UTSW 11 6217777 missense probably benign 0.30
X0022:Npc1l1 UTSW 11 6228058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCCCTGGTAATGTAAAGG -3'
(R):5'- TGGATTCCAAGGCTACTCTGG -3'

Sequencing Primer
(F):5'- CCATTACAAAGCTTACTGGATGCTG -3'
(R):5'- AAGGCTACTCTGGGCCTAG -3'
Posted On2018-05-04