Incidental Mutation 'R6477:Olfr1154'
ID516825
Institutional Source Beutler Lab
Gene Symbol Olfr1154
Ensembl Gene ENSMUSG00000075146
Gene Nameolfactory receptor 1154
SynonymsGA_x6K02T2Q125-49403456-49402524, MOR173-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6477 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87901256-87905166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87902990 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 229 (S229P)
Ref Sequence ENSEMBL: ENSMUSP00000148909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099844] [ENSMUST00000215017] [ENSMUST00000215862] [ENSMUST00000217436]
Predicted Effect probably damaging
Transcript: ENSMUST00000099844
AA Change: S229P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097432
Gene: ENSMUSG00000075146
AA Change: S229P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.1e-47 PFAM
Pfam:7tm_1 41 289 3.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215017
AA Change: S229P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215862
AA Change: S229P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217436
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Olfr1154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Olfr1154 APN 2 87903527 missense probably benign 0.00
IGL01878:Olfr1154 APN 2 87903331 nonsense probably null
IGL02683:Olfr1154 APN 2 87903104 missense possibly damaging 0.80
IGL02836:Olfr1154 APN 2 87903380 missense possibly damaging 0.81
R0432:Olfr1154 UTSW 2 87902960 missense probably damaging 1.00
R1123:Olfr1154 UTSW 2 87902904 missense probably damaging 0.99
R1223:Olfr1154 UTSW 2 87902819 missense probably damaging 0.99
R1561:Olfr1154 UTSW 2 87903161 missense probably benign 0.00
R1964:Olfr1154 UTSW 2 87903667 missense probably benign 0.00
R2041:Olfr1154 UTSW 2 87902797 missense probably damaging 1.00
R2219:Olfr1154 UTSW 2 87902925 nonsense probably null
R2233:Olfr1154 UTSW 2 87903475 missense probably damaging 1.00
R3719:Olfr1154 UTSW 2 87903103 missense probably benign 0.05
R4826:Olfr1154 UTSW 2 87903349 missense probably damaging 1.00
R4908:Olfr1154 UTSW 2 87903189 missense probably damaging 1.00
R5056:Olfr1154 UTSW 2 87903571 missense probably damaging 1.00
R5589:Olfr1154 UTSW 2 87903347 missense probably benign 0.26
R6532:Olfr1154 UTSW 2 87903202 missense probably damaging 1.00
R6666:Olfr1154 UTSW 2 87903508 missense probably damaging 1.00
R6693:Olfr1154 UTSW 2 87903308 missense probably damaging 1.00
R6724:Olfr1154 UTSW 2 87903602 missense probably benign 0.00
R7784:Olfr1154 UTSW 2 87903193 missense probably benign 0.01
Z1088:Olfr1154 UTSW 2 87903584 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATTTGACGTCTTTGTTCCTGAGAC -3'
(R):5'- CCAATTGTCATTCTGCTCCAAAG -3'

Sequencing Primer
(F):5'- TCCATTGAATGGCCTGT -3'
(R):5'- GTCATTCTGCTCCAAAGTAATTAACC -3'
Posted On2018-05-21