Incidental Mutation 'R6477:Dido1'
ID516829
Institutional Source Beutler Lab
Gene Symbol Dido1
Ensembl Gene ENSMUSG00000038914
Gene Namedeath inducer-obliterator 1
Synonyms6720461J16Rik, DIO-1, Datf1, D130048F08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_175551; MGI: 1344352

Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R6477 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location180657964-180709999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180660481 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1877 (T1877S)
Ref Sequence ENSEMBL: ENSMUSP00000084794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087517]
Predicted Effect probably benign
Transcript: ENSMUST00000087517
AA Change: T1877S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: T1877S

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 1e-22 PFAM
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1279 1308 N/A INTRINSIC
low complexity region 1372 1391 N/A INTRINSIC
coiled coil region 1458 1502 N/A INTRINSIC
low complexity region 1649 1680 N/A INTRINSIC
low complexity region 1748 1766 N/A INTRINSIC
low complexity region 1780 1792 N/A INTRINSIC
low complexity region 1804 1815 N/A INTRINSIC
internal_repeat_2 1816 1852 3.9e-5 PROSPERO
internal_repeat_1 1819 1859 6.92e-7 PROSPERO
internal_repeat_2 1926 1964 3.9e-5 PROSPERO
internal_repeat_1 1940 1982 6.92e-7 PROSPERO
low complexity region 2025 2045 N/A INTRINSIC
low complexity region 2123 2160 N/A INTRINSIC
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2182 2239 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Dido1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dido1 APN 2 180683989 missense probably benign
IGL00834:Dido1 APN 2 180689526 missense possibly damaging 0.87
IGL01317:Dido1 APN 2 180671757 missense probably benign 0.17
IGL01588:Dido1 APN 2 180688875 missense probably benign 0.00
IGL01834:Dido1 APN 2 180684031 splice site probably benign
IGL02102:Dido1 APN 2 180662247 missense possibly damaging 0.58
IGL02556:Dido1 APN 2 180689335 missense possibly damaging 0.69
IGL02756:Dido1 APN 2 180661923 missense probably benign 0.00
IGL02826:Dido1 APN 2 180683958 missense probably benign
IGL02970:Dido1 APN 2 180689415 missense probably damaging 0.99
IGL03110:Dido1 APN 2 180689342 missense probably damaging 1.00
IGL03116:Dido1 APN 2 180670979 missense probably damaging 1.00
3370:Dido1 UTSW 2 180671542 missense probably benign
A4554:Dido1 UTSW 2 180675371 missense probably damaging 1.00
H8441:Dido1 UTSW 2 180689014 missense probably benign 0.12
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0127:Dido1 UTSW 2 180671824 missense probably benign 0.01
R0620:Dido1 UTSW 2 180659851 missense probably benign 0.26
R0734:Dido1 UTSW 2 180660042 missense probably benign 0.01
R1390:Dido1 UTSW 2 180685124 missense possibly damaging 0.70
R1445:Dido1 UTSW 2 180671470 missense possibly damaging 0.62
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1472:Dido1 UTSW 2 180660720 missense probably benign 0.02
R1538:Dido1 UTSW 2 180684970 missense possibly damaging 0.49
R1584:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R2020:Dido1 UTSW 2 180659585 missense unknown
R2025:Dido1 UTSW 2 180689181 nonsense probably null
R2026:Dido1 UTSW 2 180689181 nonsense probably null
R2027:Dido1 UTSW 2 180689181 nonsense probably null
R2089:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2495:Dido1 UTSW 2 180689388 missense probably benign 0.00
R2931:Dido1 UTSW 2 180661653 missense probably damaging 1.00
R3418:Dido1 UTSW 2 180660935 missense possibly damaging 0.84
R3735:Dido1 UTSW 2 180684036 splice site probably benign
R4523:Dido1 UTSW 2 180672292 missense probably damaging 1.00
R4674:Dido1 UTSW 2 180687559 missense probably damaging 0.97
R4729:Dido1 UTSW 2 180687650 missense probably benign 0.00
R4762:Dido1 UTSW 2 180689575 missense probably damaging 1.00
R4786:Dido1 UTSW 2 180670871 missense possibly damaging 0.85
R4817:Dido1 UTSW 2 180661416 missense probably benign 0.02
R4892:Dido1 UTSW 2 180675029 nonsense probably null
R4979:Dido1 UTSW 2 180660813 missense probably damaging 0.98
R5510:Dido1 UTSW 2 180685173 missense probably benign 0.00
R5586:Dido1 UTSW 2 180659652 nonsense probably null
R5672:Dido1 UTSW 2 180671903 missense probably damaging 0.99
R5863:Dido1 UTSW 2 180661773 missense probably benign 0.02
R5943:Dido1 UTSW 2 180661882 missense probably benign 0.00
R5974:Dido1 UTSW 2 180671497 missense probably benign 0.02
R6123:Dido1 UTSW 2 180683967 missense probably benign 0.07
R6214:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6215:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6248:Dido1 UTSW 2 180660255 missense probably damaging 1.00
R6285:Dido1 UTSW 2 180661147 missense probably benign 0.00
R6349:Dido1 UTSW 2 180660701 missense probably benign 0.03
R6437:Dido1 UTSW 2 180675013 missense probably damaging 1.00
R6836:Dido1 UTSW 2 180662307 missense probably benign 0.16
R7055:Dido1 UTSW 2 180661209 missense probably benign 0.09
R7289:Dido1 UTSW 2 180659631 missense unknown
R7304:Dido1 UTSW 2 180687493 missense probably damaging 1.00
R7343:Dido1 UTSW 2 180675121 missense possibly damaging 0.49
R7363:Dido1 UTSW 2 180662517 nonsense probably null
R7429:Dido1 UTSW 2 180689526 missense possibly damaging 0.87
R7594:Dido1 UTSW 2 180675112 missense probably benign
R7629:Dido1 UTSW 2 180661473 missense probably benign
R7899:Dido1 UTSW 2 180671597 missense possibly damaging 0.82
R7946:Dido1 UTSW 2 180661708 missense possibly damaging 0.81
R7951:Dido1 UTSW 2 180670881 missense probably benign 0.01
R8033:Dido1 UTSW 2 180674842 missense probably damaging 1.00
R8069:Dido1 UTSW 2 180660912 missense probably benign
R8331:Dido1 UTSW 2 180660449 missense probably benign 0.00
R8479:Dido1 UTSW 2 180673229 critical splice donor site probably null
V1024:Dido1 UTSW 2 180689014 missense probably benign 0.12
X0011:Dido1 UTSW 2 180660834 missense probably benign 0.00
X0019:Dido1 UTSW 2 180671572 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTTTCAAACTGACTAGGATGGGGC -3'
(R):5'- CAGATTTGGGGCACAGAAGC -3'

Sequencing Primer
(F):5'- TGGGCCCACGAAATGAC -3'
(R):5'- AGAAGCCACCAATCCCTTCCTTATTC -3'
Posted On2018-05-21