Mutagenetix > Incidental Mutation

Incidental Mutation 'R6521:Erbb4'

521237

Institutional Source

Beutler Lab

Gene Symbol

Erbb4

Ensembl Gene

ENSMUSG00000062209

Gene Name

erb-b2 receptor tyrosine kinase 4

Synonyms

Her4, ErbB4

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6521 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68032186-69108059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 68042530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1131 (D1131V)

Ref Sequence

ENSEMBL: ENSMUSP00000112713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473]

AlphaFold

Q61527

Predicted Effect

probably damaging
Transcript: ENSMUST00000119142
AA Change: D1131V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: D1131V

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	5e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	1e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121473
AA Change: D1115V

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: D1115V

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	1.6e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	5.5e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.0%

Validation Efficiency

100% (48/48)

MGI Phenotype

Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars	T	A	8: 111,043,336	S356T	probably benign	Het
Acsbg2	T	C	17: 56,861,565	M185V	probably benign	Het
Adgrv1	A	T	13: 81,433,652	F4758I	probably damaging	Het
Ank3	A	G	10: 69,992,766		probably benign	Het
Ankfy1	G	A	11: 72,730,482	R198Q	possibly damaging	Het
Ano4	A	G	10: 88,983,778	V537A	probably damaging	Het
Catsper2	A	G	2: 121,406,807	L204P	probably damaging	Het
Cdh20	A	C	1: 104,942,134	D193A	probably damaging	Het
Ceacam5	T	C	7: 17,750,831		probably null	Het
Celf4	T	A	18: 25,479,474		probably null	Het
Crebbp	A	T	16: 4,119,128	F754I	probably damaging	Het
Cyfip2	A	T	11: 46,254,588	I635N	probably damaging	Het
Fsip2	A	G	2: 82,990,086	T5388A	possibly damaging	Het
Hoxc8	G	A	15: 102,992,703	V193M	probably benign	Het
Klhdc3	A	G	17: 46,677,761	V124A	probably benign	Het
Klhl18	A	G	9: 110,428,635	I509T	possibly damaging	Het
Maats1	A	G	16: 38,306,759	V545A	probably benign	Het
Mdfic	T	A	6: 15,729,028		probably benign	Het
Mkln1	T	A	6: 31,490,544	D64E	probably damaging	Het
Mmd2	A	G	5: 142,574,830	I112T	probably damaging	Het
Mpl	C	T	4: 118,455,117		probably null	Het
Mtmr4	A	G	11: 87,613,527	T1044A	possibly damaging	Het
Muc5b	C	A	7: 141,859,171	Y1951*	probably null	Het
Myo15	C	T	11: 60,502,369	H2240Y	probably damaging	Het
Nckap5	A	T	1: 126,382,172	I74K	probably damaging	Het
Nfxl1	A	T	5: 72,540,308		probably null	Het
Olfr1018	A	T	2: 85,823,450	I160F	probably benign	Het
Olfr1205	A	G	2: 88,831,356	I80V	probably benign	Het
Olfr736	T	C	14: 50,393,548	V264A	possibly damaging	Het
Olfr924	C	T	9: 38,848,597	T161I	probably benign	Het
Piezo2	T	C	18: 63,021,328	Y2460C	probably damaging	Het
Pigx	A	G	16: 32,087,311	L64P	probably damaging	Het
Prss1	C	T	6: 41,463,681	T230I	probably damaging	Het
Ptma	A	G	1: 86,527,847		probably null	Het
Rab39	T	C	9: 53,706,031	T29A	probably benign	Het
Rem2	C	T	14: 54,477,687	A107V	possibly damaging	Het
Senp1	A	G	15: 98,048,271	V531A	probably damaging	Het
Serhl	A	G	15: 83,101,642		probably null	Het
Sirpa	T	G	2: 129,630,155	Y164D	probably damaging	Het
Slc12a3	T	C	8: 94,343,113	I550T	possibly damaging	Het
Slc22a14	T	C	9: 119,220,769		probably null	Het
Slfn5	A	G	11: 82,960,415	N513D	probably damaging	Het
Sptan1	T	C	2: 30,020,455	S1831P	possibly damaging	Het
Swap70	T	C	7: 110,255,820	L109P	probably benign	Het
Tas2r119	G	A	15: 32,178,173	C295Y	probably damaging	Het
Tcaf3	T	A	6: 42,593,238	I527L	probably damaging	Het
Traj31	A	G	14: 54,187,930		probably benign	Het
Unc5a	T	A	13: 55,004,935	D887E	probably benign	Het
Zfp407	T	A	18: 84,432,411	H1600L	probably damaging	Het

Other mutations in Erbb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Erbb4	APN	1	68071630	nonsense	probably null
IGL01020:Erbb4	APN	1	68298449	splice site	probably benign
IGL01349:Erbb4	APN	1	68346593	missense	probably benign	0.00
IGL01386:Erbb4	APN	1	68343931	missense	probably damaging	1.00
IGL01516:Erbb4	APN	1	68328245	nonsense	probably null
IGL01536:Erbb4	APN	1	68290282	missense	probably benign	0.00
IGL01721:Erbb4	APN	1	68254563	missense	possibly damaging	0.46
IGL01832:Erbb4	APN	1	68254566	missense	possibly damaging	0.84
IGL02002:Erbb4	APN	1	68080726	missense	probably damaging	1.00
IGL02040:Erbb4	APN	1	68042535	missense	probably damaging	1.00
IGL02371:Erbb4	APN	1	68290294	missense	probably benign	0.00
IGL02399:Erbb4	APN	1	68042437	splice site	probably benign
IGL02553:Erbb4	APN	1	68305864	missense	probably benign	0.17
IGL03118:Erbb4	APN	1	68042719	missense	probably benign	0.11
IGL03329:Erbb4	APN	1	68328122	missense	probably benign	0.30
IGL03405:Erbb4	APN	1	68330238	missense	probably benign	0.02
earthworm	UTSW	1	68250580	missense	possibly damaging	0.67
excrescence	UTSW	1	68330246	missense	probably damaging	1.00
Mole	UTSW	1	68560576	missense	probably damaging	1.00
P0018:Erbb4	UTSW	1	68071676	missense	probably benign	0.05
PIT4480001:Erbb4	UTSW	1	68075543	missense	probably damaging	1.00
R0193:Erbb4	UTSW	1	68043960	intron	probably benign
R0329:Erbb4	UTSW	1	68298280	splice site	probably benign
R0335:Erbb4	UTSW	1	68259259	missense	probably benign
R0362:Erbb4	UTSW	1	68330270	missense	probably damaging	0.99
R0579:Erbb4	UTSW	1	68042462	missense	probably benign	0.17
R0730:Erbb4	UTSW	1	68259290	missense	probably damaging	0.98
R1029:Erbb4	UTSW	1	68309614	missense	probably damaging	0.96
R1444:Erbb4	UTSW	1	68254600	missense	probably damaging	1.00
R1469:Erbb4	UTSW	1	68560682	missense	probably damaging	0.99
R1469:Erbb4	UTSW	1	68560682	missense	probably damaging	0.99
R1503:Erbb4	UTSW	1	68346546	missense	probably benign	0.00
R1523:Erbb4	UTSW	1	68396252	missense	possibly damaging	0.95
R1528:Erbb4	UTSW	1	68078582	nonsense	probably null
R1604:Erbb4	UTSW	1	68346569	missense	possibly damaging	0.88
R1611:Erbb4	UTSW	1	68040388	missense	probably damaging	1.00
R1642:Erbb4	UTSW	1	68331234	missense	probably damaging	1.00
R1905:Erbb4	UTSW	1	68075410	splice site	probably benign
R1929:Erbb4	UTSW	1	68198888	missense	probably damaging	0.98
R2046:Erbb4	UTSW	1	68298323	missense	probably benign	0.02
R2139:Erbb4	UTSW	1	68346629	missense	probably damaging	0.96
R2271:Erbb4	UTSW	1	68198888	missense	probably damaging	0.98
R2298:Erbb4	UTSW	1	68042531	missense	probably damaging	1.00
R2356:Erbb4	UTSW	1	68078596	missense	probably benign	0.00
R3821:Erbb4	UTSW	1	68305913	missense	probably damaging	0.97
R4007:Erbb4	UTSW	1	68740401	missense	probably damaging	1.00
R4012:Erbb4	UTSW	1	68560576	missense	probably damaging	1.00
R4077:Erbb4	UTSW	1	68040337	missense	probably benign	0.07
R4196:Erbb4	UTSW	1	68343855	missense	possibly damaging	0.90
R4536:Erbb4	UTSW	1	68346622	missense	probably damaging	1.00
R4561:Erbb4	UTSW	1	68343921	nonsense	probably null
R4642:Erbb4	UTSW	1	68250632	missense	probably damaging	1.00
R4737:Erbb4	UTSW	1	68343900	missense	probably damaging	0.98
R4739:Erbb4	UTSW	1	68343900	missense	probably damaging	0.98
R4780:Erbb4	UTSW	1	68298314	missense	probably damaging	1.00
R4801:Erbb4	UTSW	1	68330246	missense	probably damaging	1.00
R4802:Erbb4	UTSW	1	68330246	missense	probably damaging	1.00
R4811:Erbb4	UTSW	1	68254544	missense	probably damaging	1.00
R4832:Erbb4	UTSW	1	68330238	missense	probably benign	0.02
R5068:Erbb4	UTSW	1	68043902	splice site	probably null
R5546:Erbb4	UTSW	1	68298293	missense	probably damaging	0.99
R5755:Erbb4	UTSW	1	68560519	missense	possibly damaging	0.96
R6189:Erbb4	UTSW	1	68043916	missense	probably benign
R6257:Erbb4	UTSW	1	68396273	missense	probably damaging	1.00
R6276:Erbb4	UTSW	1	68560576	missense	probably damaging	1.00
R6602:Erbb4	UTSW	1	68370503	missense	probably damaging	0.99
R6808:Erbb4	UTSW	1	68040303	missense	probably benign	0.00
R7087:Erbb4	UTSW	1	68740491	missense	probably null	1.00
R7215:Erbb4	UTSW	1	68339460	missense	probably benign
R7356:Erbb4	UTSW	1	68339355	critical splice donor site	probably null
R7509:Erbb4	UTSW	1	68250580	missense	possibly damaging	0.67
R7593:Erbb4	UTSW	1	68254599	missense	probably damaging	0.99
R7743:Erbb4	UTSW	1	68328119	missense	probably benign	0.00
R7784:Erbb4	UTSW	1	68075499	missense	probably damaging	1.00
R7815:Erbb4	UTSW	1	68042726	missense	probably damaging	1.00
R7923:Erbb4	UTSW	1	68259209	missense	probably damaging	1.00
R8071:Erbb4	UTSW	1	68396311	missense	probably damaging	1.00
R8288:Erbb4	UTSW	1	68298350	missense	probably damaging	1.00
R8356:Erbb4	UTSW	1	68071630	missense	probably damaging	1.00
R8456:Erbb4	UTSW	1	68071630	missense	probably damaging	1.00
R8464:Erbb4	UTSW	1	68309626	missense	probably benign
R8783:Erbb4	UTSW	1	68040172	missense	possibly damaging	0.95
R8830:Erbb4	UTSW	1	68075468	missense	probably damaging	1.00
R8881:Erbb4	UTSW	1	68343838	critical splice donor site	probably null
R9053:Erbb4	UTSW	1	68250620	missense	possibly damaging	0.63
R9142:Erbb4	UTSW	1	68349393	missense	probably damaging	1.00
R9237:Erbb4	UTSW	1	68042442	missense	possibly damaging	0.72
R9350:Erbb4	UTSW	1	68290479	missense	probably benign	0.00
R9374:Erbb4	UTSW	1	68740483	nonsense	probably null
R9434:Erbb4	UTSW	1	68042614	missense	possibly damaging	0.84
R9499:Erbb4	UTSW	1	68740483	nonsense	probably null
R9551:Erbb4	UTSW	1	68740483	nonsense	probably null
R9753:Erbb4	UTSW	1	68198903	missense	probably benign	0.00
X0019:Erbb4	UTSW	1	68073145	missense	probably benign	0.00
Z1176:Erbb4	UTSW	1	68298402	frame shift	probably null
Z1176:Erbb4	UTSW	1	68328259	nonsense	probably null
Z1177:Erbb4	UTSW	1	68259183	frame shift	probably null
Z1177:Erbb4	UTSW	1	68290476	missense	probably damaging	1.00
Z1177:Erbb4	UTSW	1	68309643	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CTATAGTTATAGTAGCCTGGGCC -3'
(R):5'- AAGGAATGCCCATGCCCTAC -3'

Sequencing Primer
(F):5'- GTCACCATTCCCCCTGGATGAAG -3'
(R):5'- TGCCCATGCCCTACAGAGC -3'

Posted On

2018-06-06