Incidental Mutation 'R6556:Fam214b'
ID522144
Institutional Source Beutler Lab
Gene Symbol Fam214b
Ensembl Gene ENSMUSG00000036002
Gene Namefamily with sequence similarity 214, member B
SynonymsB230312A22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43032414-43046220 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43033896 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 460 (R460H)
Ref Sequence ENSEMBL: ENSMUSP00000103593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030169] [ENSMUST00000036462] [ENSMUST00000107956] [ENSMUST00000107957] [ENSMUST00000107958] [ENSMUST00000107959] [ENSMUST00000124155] [ENSMUST00000152846] [ENSMUST00000138030] [ENSMUST00000135067] [ENSMUST00000136326] [ENSMUST00000144999]
Predicted Effect probably benign
Transcript: ENSMUST00000030169
SMART Domains Protein: ENSMUSP00000030169
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PHB 36 194 1.47e-57 SMART
coiled coil region 231 252 N/A INTRINSIC
Pfam:Band_7_C 259 321 2.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036462
AA Change: R460H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038177
Gene: ENSMUSG00000036002
AA Change: R460H

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107956
AA Change: R460H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103590
Gene: ENSMUSG00000036002
AA Change: R460H

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107957
AA Change: R460H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103591
Gene: ENSMUSG00000036002
AA Change: R460H

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107958
AA Change: R460H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103592
Gene: ENSMUSG00000036002
AA Change: R460H

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107959
AA Change: R460H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103593
Gene: ENSMUSG00000036002
AA Change: R460H

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 480 537 8.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123465
Predicted Effect probably benign
Transcript: ENSMUST00000124155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143371
Predicted Effect probably benign
Transcript: ENSMUST00000135660
SMART Domains Protein: ENSMUSP00000123478
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 2 153 4.16e-39 SMART
coiled coil region 189 210 N/A INTRINSIC
Pfam:Band_7_C 218 280 3.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152846
SMART Domains Protein: ENSMUSP00000118228
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140998
Predicted Effect probably benign
Transcript: ENSMUST00000138030
SMART Domains Protein: ENSMUSP00000118465
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PHB 42 200 1.47e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135067
SMART Domains Protein: ENSMUSP00000122882
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136326
SMART Domains Protein: ENSMUSP00000117586
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 1 148 1.33e-37 SMART
coiled coil region 185 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144999
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Fam214b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:Fam214b APN 4 43036468 nonsense probably null
IGL02810:Fam214b APN 4 43034429 missense probably damaging 1.00
BB010:Fam214b UTSW 4 43035919 missense probably benign
BB020:Fam214b UTSW 4 43035919 missense probably benign
PIT4431001:Fam214b UTSW 4 43036024 missense probably damaging 0.99
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0565:Fam214b UTSW 4 43034647 unclassified probably benign
R0627:Fam214b UTSW 4 43036242 missense probably damaging 1.00
R1121:Fam214b UTSW 4 43034947 missense probably damaging 1.00
R2395:Fam214b UTSW 4 43035964 nonsense probably null
R2853:Fam214b UTSW 4 43036293 missense probably benign
R3878:Fam214b UTSW 4 43035867 missense probably damaging 1.00
R4688:Fam214b UTSW 4 43034663 missense probably damaging 1.00
R6467:Fam214b UTSW 4 43033687 missense probably damaging 1.00
R7107:Fam214b UTSW 4 43036434 missense probably benign 0.10
R7608:Fam214b UTSW 4 43036533 missense probably damaging 0.99
R7933:Fam214b UTSW 4 43035919 missense probably benign
R7982:Fam214b UTSW 4 43034483 missense probably damaging 1.00
R8328:Fam214b UTSW 4 43034751 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATCTCCATGCAGGCTTAAGC -3'
(R):5'- CCATCCAAGTGGTGAGTGAC -3'

Sequencing Primer
(F):5'- TGTGAGCACGTCAGCATC -3'
(R):5'- ATCAGTCAGTAGGCCCTAC -3'
Posted On2018-06-06