Incidental Mutation 'R6556:Cdh13'
ID522170
Institutional Source Beutler Lab
Gene Symbol Cdh13
Ensembl Gene ENSMUSG00000031841
Gene Namecadherin 13
SynonymsT-cadherin, 4932416G01Rik, Tcad
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location118283733-119324921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118968187 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 259 (P259S)
Ref Sequence ENSEMBL: ENSMUSP00000113527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117160]
PDB Structure
Crystal Structure of mouse T-cadherin EC1 EC2 [X-RAY DIFFRACTION]
Crystal structure of mouse T-cadherin EC1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000117160
AA Change: P259S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113527
Gene: ENSMUSG00000031841
AA Change: P259S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Cadherin_pro 26 112 1.04e-17 SMART
CA 160 243 1.49e-18 SMART
CA 267 361 1.84e-23 SMART
CA 383 476 8.75e-16 SMART
CA 499 583 2.36e-21 SMART
CA 604 687 5.93e-2 SMART
low complexity region 695 714 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148836
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is highly expressed in the vasculature including endothelial cells, smooth muscle cells and pericytes, where the encoded protein binds to adiponectin and has been implicated in the modulation of angiogenesis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased retinal neovascularization and increased adiponectin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Cdh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Cdh13 APN 8 119312506 missense possibly damaging 0.87
IGL00659:Cdh13 APN 8 119312667 missense probably damaging 1.00
IGL01662:Cdh13 APN 8 118675177 missense probably damaging 0.99
IGL01719:Cdh13 APN 8 118675188 missense probably benign 0.01
IGL02148:Cdh13 APN 8 119198958 missense probably damaging 1.00
IGL02157:Cdh13 APN 8 118505671 missense possibly damaging 0.68
IGL02188:Cdh13 APN 8 118851761 missense probably benign 0.08
IGL02490:Cdh13 APN 8 119095323 missense probably damaging 1.00
IGL02851:Cdh13 APN 8 118675158 missense probably benign 0.32
IGL02958:Cdh13 APN 8 119312721 missense possibly damaging 0.90
IGL03085:Cdh13 APN 8 119288724 missense probably damaging 1.00
IGL03230:Cdh13 APN 8 119242317 missense probably damaging 1.00
IGL03280:Cdh13 APN 8 119314134 missense probably damaging 1.00
K3955:Cdh13 UTSW 8 118675104 missense probably damaging 0.99
P0038:Cdh13 UTSW 8 118675104 missense probably damaging 0.99
R0398:Cdh13 UTSW 8 119314047 missense probably damaging 1.00
R2156:Cdh13 UTSW 8 119236964 missense probably damaging 1.00
R3415:Cdh13 UTSW 8 118675207 missense probably benign 0.35
R4243:Cdh13 UTSW 8 119242257 missense probably damaging 1.00
R4839:Cdh13 UTSW 8 118851848 nonsense probably null
R4851:Cdh13 UTSW 8 118757390 missense possibly damaging 0.75
R5129:Cdh13 UTSW 8 119095215 missense probably damaging 1.00
R5453:Cdh13 UTSW 8 119198967 missense probably damaging 1.00
R5607:Cdh13 UTSW 8 118757474 missense probably benign
R5608:Cdh13 UTSW 8 118757474 missense probably benign
R5610:Cdh13 UTSW 8 118851723 missense possibly damaging 0.95
R6035:Cdh13 UTSW 8 118505698 missense probably benign 0.03
R6035:Cdh13 UTSW 8 118505698 missense probably benign 0.03
R7124:Cdh13 UTSW 8 118968173 missense probably damaging 1.00
R7349:Cdh13 UTSW 8 119242358 missense probably damaging 0.97
R7418:Cdh13 UTSW 8 119312525 missense probably damaging 1.00
R7679:Cdh13 UTSW 8 119236919 missense probably benign 0.29
R7807:Cdh13 UTSW 8 118283855 start codon destroyed probably null 0.77
X0025:Cdh13 UTSW 8 118505679 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GAAATGACGGTTTCTTTCTCTCCTG -3'
(R):5'- TGGACGTAACATCACCCCTG -3'

Sequencing Primer
(F):5'- CCTGATCTCTTTGCTCCAACAG -3'
(R):5'- AGGCACTTTCATAGTTTGCAGTC -3'
Posted On2018-06-06