Mutagenetix > Incidental Mutations

Incidental Mutation 'R6556:Cdh13'

522170

Institutional Source

Beutler Lab

Gene Symbol

Cdh13

Ensembl Gene

ENSMUSG00000031841

Gene Name

cadherin 13

Synonyms

T-cadherin, 4932416G01Rik, Tcad

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6556 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118283733-119324921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 118968187 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 259 (P259S)

Ref Sequence

ENSEMBL: ENSMUSP00000113527 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117160]

AlphaFold

Q9WTR5

PDB Structure

Crystal Structure of mouse T-cadherin EC1 EC2 [X-RAY DIFFRACTION]
Crystal structure of mouse T-cadherin EC1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000117160
AA Change: P259S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113527
Gene: ENSMUSG00000031841
AA Change: P259S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Cadherin_pro	26	112	1.04e-17	SMART
CA	160	243	1.49e-18	SMART
CA	267	361	1.84e-23	SMART
CA	383	476	8.75e-16	SMART
CA	499	583	2.36e-21	SMART
CA	604	687	5.93e-2	SMART
low complexity region	695	714	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142551

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148836

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is highly expressed in the vasculature including endothelial cells, smooth muscle cells and pericytes, where the encoded protein binds to adiponectin and has been implicated in the modulation of angiogenesis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased retinal neovascularization and increased adiponectin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029P11Rik	A	G	15: 81,980,738	D60G	probably damaging	Het
2310035C23Rik	T	A	1: 105,726,440	F845I	probably damaging	Het
4930539E08Rik	T	A	17: 28,904,611	D114V	probably damaging	Het
AF366264	G	A	8: 13,837,690	Q134*	probably null	Het
Atp2a1	G	T	7: 126,450,262	P536Q	probably benign	Het
Cabyr	T	A	18: 12,751,016	S187T	probably benign	Het
Camkk1	A	T	11: 73,033,870	N303I	probably benign	Het
Csnk1g3	A	G	18: 53,930,282	D255G	possibly damaging	Het
Dennd5b	A	C	6: 149,014,251		probably null	Het
Dnajc14	A	G	10: 128,814,631	D528G	probably benign	Het
Edem1	T	C	6: 108,854,357	F593S	probably benign	Het
Erbb2	G	A	11: 98,436,082	D1106N	possibly damaging	Het
Ermp1	T	C	19: 29,612,921	M794V	possibly damaging	Het
Fam208a	T	G	14: 27,429,258	Y64D	probably benign	Het
Fam214b	C	T	4: 43,033,896	R460H	probably damaging	Het
Fip1l1	T	A	5: 74,547,177		probably null	Het
Gm11639	A	G	11: 105,008,251	N4343S	probably null	Het
Gm20730	C	T	6: 43,081,542	C112Y	probably damaging	Het
Gtf2h1	T	A	7: 46,808,665	C245S	probably damaging	Het
Hdhd5	T	C	6: 120,523,554	H61R	probably benign	Het
Ighv1-71	A	T	12: 115,742,472	V31E	probably damaging	Het
Igsf9b	T	C	9: 27,329,555	F688S	probably damaging	Het
Iqcd	T	C	5: 120,602,378	V258A	probably damaging	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Lpo	G	T	11: 87,817,763	Y136*	probably null	Het
Med30	A	G	15: 52,730,383		probably benign	Het
Mertk	T	A	2: 128,776,421	V524D	probably benign	Het
Olfr1156	T	C	2: 87,949,976	I86V	probably benign	Het
Olfr1261	T	A	2: 89,994,173	F260Y	probably benign	Het
Olfr1263	T	C	2: 90,015,094	Y55H	probably damaging	Het
Pde6b	T	A	5: 108,421,501	M358K	possibly damaging	Het
Prep	GA	G	10: 45,158,314		probably null	Het
Prpf4b	G	A	13: 34,896,032	R793Q	probably damaging	Het
Rela	T	A	19: 5,647,338	N524K	probably damaging	Het
Rnaset2a	T	C	17: 8,141,648	D74G	probably damaging	Het
Serinc2	T	A	4: 130,258,271	I267F	probably damaging	Het
Sesn3	T	C	9: 14,321,253	F274S	possibly damaging	Het
Spag1	T	C	15: 36,195,407	Y249H	probably damaging	Het
Sstr1	A	T	12: 58,213,692	D367V	possibly damaging	Het
Tnnt1	T	C	7: 4,509,577	E110G	probably damaging	Het
Tpm1	T	A	9: 67,028,169		probably null	Het
Unc93b1	T	C	19: 3,944,105	V412A	probably benign	Het
Uox	G	C	3: 146,624,648		probably null	Het
Usp44	T	C	10: 93,846,008	Y107H	probably benign	Het

Other mutations in Cdh13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Cdh13	APN	8	119312506	missense	possibly damaging	0.87
IGL00659:Cdh13	APN	8	119312667	missense	probably damaging	1.00
IGL01662:Cdh13	APN	8	118675177	missense	probably damaging	0.99
IGL01719:Cdh13	APN	8	118675188	missense	probably benign	0.01
IGL02148:Cdh13	APN	8	119198958	missense	probably damaging	1.00
IGL02157:Cdh13	APN	8	118505671	missense	possibly damaging	0.68
IGL02188:Cdh13	APN	8	118851761	missense	probably benign	0.08
IGL02490:Cdh13	APN	8	119095323	missense	probably damaging	1.00
IGL02851:Cdh13	APN	8	118675158	missense	probably benign	0.32
IGL02958:Cdh13	APN	8	119312721	missense	possibly damaging	0.90
IGL03085:Cdh13	APN	8	119288724	missense	probably damaging	1.00
IGL03230:Cdh13	APN	8	119242317	missense	probably damaging	1.00
IGL03280:Cdh13	APN	8	119314134	missense	probably damaging	1.00
K3955:Cdh13	UTSW	8	118675104	missense	probably damaging	0.99
P0038:Cdh13	UTSW	8	118675104	missense	probably damaging	0.99
R0398:Cdh13	UTSW	8	119314047	missense	probably damaging	1.00
R2156:Cdh13	UTSW	8	119236964	missense	probably damaging	1.00
R3415:Cdh13	UTSW	8	118675207	missense	probably benign	0.35
R4243:Cdh13	UTSW	8	119242257	missense	probably damaging	1.00
R4839:Cdh13	UTSW	8	118851848	nonsense	probably null
R4851:Cdh13	UTSW	8	118757390	missense	possibly damaging	0.75
R5129:Cdh13	UTSW	8	119095215	missense	probably damaging	1.00
R5453:Cdh13	UTSW	8	119198967	missense	probably damaging	1.00
R5607:Cdh13	UTSW	8	118757474	missense	probably benign
R5608:Cdh13	UTSW	8	118757474	missense	probably benign
R5610:Cdh13	UTSW	8	118851723	missense	possibly damaging	0.95
R6035:Cdh13	UTSW	8	118505698	missense	probably benign	0.03
R6035:Cdh13	UTSW	8	118505698	missense	probably benign	0.03
R7124:Cdh13	UTSW	8	118968173	missense	probably damaging	1.00
R7349:Cdh13	UTSW	8	119242358	missense	probably damaging	0.97
R7418:Cdh13	UTSW	8	119312525	missense	probably damaging	1.00
R7679:Cdh13	UTSW	8	119236919	missense	probably benign	0.29
R7807:Cdh13	UTSW	8	118283855	start codon destroyed	probably null	0.77
R8777:Cdh13	UTSW	8	119236967	critical splice donor site	probably null
R8777-TAIL:Cdh13	UTSW	8	119236967	critical splice donor site	probably null
R9175:Cdh13	UTSW	8	119242229	missense	probably damaging	1.00
X0025:Cdh13	UTSW	8	118505679	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- GAAATGACGGTTTCTTTCTCTCCTG -3'
(R):5'- TGGACGTAACATCACCCCTG -3'

Sequencing Primer
(F):5'- CCTGATCTCTTTGCTCCAACAG -3'
(R):5'- AGGCACTTTCATAGTTTGCAGTC -3'

Posted On

2018-06-06