Incidental Mutation 'R6609:Pxdn'
ID525846
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R6609 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30002941 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1039 (V1039A)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably benign
Transcript: ENSMUST00000122328
AA Change: V1039A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: V1039A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218620
Predicted Effect probably benign
Transcript: ENSMUST00000220271
AA Change: V859A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C T 12: 118,928,762 V421I probably damaging Het
Bpifb3 T A 2: 153,920,648 probably null Het
C1rl T C 6: 124,508,624 V318A probably benign Het
Cacna1b C T 2: 24,653,049 V1264M probably damaging Het
Cacna1s A G 1: 136,113,391 D1551G probably benign Het
Cdc42bpa T G 1: 180,101,274 probably null Het
Cdc7 G A 5: 106,973,058 R182H probably benign Het
Cyth1 A T 11: 118,170,860 L309Q probably damaging Het
Dnah6 G A 6: 73,053,695 T3378I possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Get4 A G 5: 139,269,065 probably benign Het
Gm136 T A 4: 34,746,526 M162L probably benign Het
Grik5 G T 7: 25,015,526 S681* probably null Het
Hsf5 C T 11: 87,635,953 P484S probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Kl A T 5: 150,988,962 K725N probably benign Het
Lama3 G A 18: 12,513,678 V144M probably damaging Het
Lrrc14 T C 15: 76,714,253 V363A probably benign Het
Mettl15 T C 2: 109,137,342 R200G probably null Het
Mki67 T C 7: 135,699,829 T1159A possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Ndufb5 C G 3: 32,741,683 T8R probably benign Het
Olfr1313 T C 2: 112,072,164 M140V probably benign Het
Olfr522 C A 7: 140,162,563 R129L probably benign Het
Pde1a T A 2: 79,906,140 D15V probably damaging Het
Plcg2 G A 8: 117,568,170 G191S probably benign Het
Ptprq T C 10: 107,572,968 T1895A probably damaging Het
Slc26a5 T C 5: 21,819,719 I456V possibly damaging Het
Smco4 C T 9: 15,544,735 A39V probably damaging Het
Tmem102 T A 11: 69,805,114 L40F probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zfp985 A T 4: 147,583,121 M149L probably benign Het
Zfp985 T C 4: 147,583,667 F331L probably damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
R8903:Pxdn UTSW 12 29990993 missense probably benign
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCATACGCTGTGGTTC -3'
(R):5'- AAACAGCCCTCGGAGAAGTG -3'

Sequencing Primer
(F):5'- TGTGGTTCCGGGAGCACAAC -3'
(R):5'- CCTCGTTGACAATCCGGAAG -3'
Posted On2018-06-22