Incidental Mutation 'R5266:Wdr41'
ID470631
Institutional Source Beutler Lab
Gene Symbol Wdr41
Ensembl Gene ENSMUSG00000042015
Gene NameWD repeat domain 41
SynonymsB830029I03Rik, MSTP048
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location94976344-95023314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94995251 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 57 (F57L)
Ref Sequence ENSEMBL: ENSMUSP00000152667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056512] [ENSMUST00000159647] [ENSMUST00000160115] [ENSMUST00000160801] [ENSMUST00000167155] [ENSMUST00000222995]
Predicted Effect probably damaging
Transcript: ENSMUST00000056512
AA Change: F57L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055145
Gene: ENSMUSG00000042015
AA Change: F57L

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159647
AA Change: F57L

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138501
Gene: ENSMUSG00000042015
AA Change: F57L

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000160115
AA Change: F57L
SMART Domains Protein: ENSMUSP00000138543
Gene: ENSMUSG00000042015
AA Change: F57L

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 1e-5 BLAST
internal_repeat_2 224 281 1.46e-11 PROSPERO
internal_repeat_1 233 315 2.35e-20 PROSPERO
internal_repeat_2 306 365 1.46e-11 PROSPERO
internal_repeat_1 353 435 2.35e-20 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160409
SMART Domains Protein: ENSMUSP00000138569
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
internal_repeat_2 1 37 2.8e-14 PROSPERO
internal_repeat_1 2 42 7.42e-17 PROSPERO
internal_repeat_1 38 78 7.42e-17 PROSPERO
internal_repeat_2 43 79 2.8e-14 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000160801
AA Change: F57L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124033
Gene: ENSMUSG00000042015
AA Change: F57L

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167155
AA Change: F57L

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129595
Gene: ENSMUSG00000042015
AA Change: F57L

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222948
Predicted Effect probably damaging
Transcript: ENSMUST00000222995
AA Change: F57L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1886 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: This gene encodes a protein of unknown function, but which contains a WD40 domain consisting of six WD40 repeats. The WD40 domain is one of the most abundant protein domains in eukaryotes, and is found in proteins with widely varying cellular functions. However, proteins with this domain often provide a rigid scaffold for protein-protein interactions. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Wdr41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Wdr41 APN 13 95017456 unclassified probably benign
IGL02813:Wdr41 APN 13 94995245 splice site probably null
gogi UTSW 13 95015217 critical splice donor site probably null
metallica UTSW 13 95015174 nonsense probably null
R0047:Wdr41 UTSW 13 95010287 missense probably damaging 1.00
R0110:Wdr41 UTSW 13 95018111 unclassified probably benign
R0243:Wdr41 UTSW 13 95017406 missense probably damaging 1.00
R0537:Wdr41 UTSW 13 94995305 splice site probably benign
R2025:Wdr41 UTSW 13 95018948 missense probably damaging 1.00
R2116:Wdr41 UTSW 13 95015029 critical splice acceptor site probably null
R3953:Wdr41 UTSW 13 94997063 missense probably damaging 1.00
R4886:Wdr41 UTSW 13 95015174 nonsense probably null
R5055:Wdr41 UTSW 13 95015217 critical splice donor site probably null
R5276:Wdr41 UTSW 13 95017450 critical splice donor site probably null
R5738:Wdr41 UTSW 13 94978488 missense possibly damaging 0.55
R5957:Wdr41 UTSW 13 94997187 critical splice donor site probably null
R6682:Wdr41 UTSW 13 95013131 missense probably damaging 1.00
R6815:Wdr41 UTSW 13 95018174 missense probably damaging 1.00
R6817:Wdr41 UTSW 13 94997304 splice site probably null
R7582:Wdr41 UTSW 13 95005767 missense probably damaging 0.97
R7832:Wdr41 UTSW 13 95015193 missense probably benign 0.06
R8003:Wdr41 UTSW 13 95013146 missense possibly damaging 0.93
R8076:Wdr41 UTSW 13 95017330 missense probably benign
R8796:Wdr41 UTSW 13 95015067 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GACCGTGGATCTCAAAATTCATG -3'
(R):5'- GTCCCTGTTGTAAACGAATATCTC -3'

Sequencing Primer
(F):5'- GTATTTTCCCAAACAAT -3'
(R):5'- CCTGTTGTAAACGAATATCTCTAACC -3'
Posted On2017-03-31