Incidental Mutation 'R6646:Krt6b'
ID527988
Institutional Source Beutler Lab
Gene Symbol Krt6b
Ensembl Gene ENSMUSG00000023041
Gene Namekeratin 6B
SynonymsKrt2-6b, mK6[b]
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101676023-101680287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101677214 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 428 (Q428L)
Ref Sequence ENSEMBL: ENSMUSP00000023786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023786]
Predicted Effect probably damaging
Transcript: ENSMUST00000023786
AA Change: Q428L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023786
Gene: ENSMUSG00000023041
AA Change: Q428L

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 1.3e-36 PFAM
Filament 151 464 2.79e-175 SMART
low complexity region 483 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198940
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Krt6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Krt6b APN 15 101679832 missense probably benign 0.22
IGL01653:Krt6b APN 15 101679114 missense probably damaging 1.00
IGL01900:Krt6b APN 15 101677546 missense possibly damaging 0.45
IGL03187:Krt6b APN 15 101679957 missense probably benign
R0511:Krt6b UTSW 15 101677607 splice site probably benign
R0788:Krt6b UTSW 15 101677519 missense probably damaging 0.96
R1370:Krt6b UTSW 15 101677552 missense probably damaging 0.96
R1481:Krt6b UTSW 15 101678374 missense probably benign 0.05
R2007:Krt6b UTSW 15 101678127 missense probably damaging 1.00
R2112:Krt6b UTSW 15 101678564 missense possibly damaging 0.48
R2166:Krt6b UTSW 15 101678615 critical splice acceptor site probably null
R2227:Krt6b UTSW 15 101679122 missense probably damaging 0.96
R2495:Krt6b UTSW 15 101678322 missense probably damaging 1.00
R2496:Krt6b UTSW 15 101679781 missense probably damaging 1.00
R4726:Krt6b UTSW 15 101678085 missense probably damaging 0.98
R4969:Krt6b UTSW 15 101680025 missense possibly damaging 0.71
R6301:Krt6b UTSW 15 101678951 missense probably damaging 1.00
R7232:Krt6b UTSW 15 101678142 missense probably damaging 1.00
R7406:Krt6b UTSW 15 101679078 missense probably benign 0.04
R7414:Krt6b UTSW 15 101679014 missense probably benign 0.05
R7849:Krt6b UTSW 15 101678574 missense probably damaging 1.00
R7932:Krt6b UTSW 15 101678574 missense probably damaging 1.00
Z1177:Krt6b UTSW 15 101678332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGAAGTGACCATGATGGG -3'
(R):5'- TGCTCACCAGAAACCATGGTC -3'

Sequencing Primer
(F):5'- ACCATGATGGGCACAGC -3'
(R):5'- ATGGTCTGGGGCTCAGC -3'
Posted On2018-07-24