Incidental Mutation 'R6646:Sorbs1'
ID527995
Institutional Source Beutler Lab
Gene Symbol Sorbs1
Ensembl Gene ENSMUSG00000025006
Gene Namesorbin and SH3 domain containing 1
Synonyms9530001P15Rik, 2310065E01Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40294753-40513779 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40325549 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 940 (G940R)
Ref Sequence ENSEMBL: ENSMUSP00000153009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224247] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]
Predicted Effect probably benign
Transcript: ENSMUST00000099466
SMART Domains Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 203 249 1.07e-26 SMART
SH3 502 557 2.72e-18 SMART
SH3 576 633 9.32e-17 SMART
low complexity region 647 660 N/A INTRINSIC
SH3 682 739 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099467
SMART Domains Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 192 213 N/A INTRINSIC
Sorb 327 373 1.24e-22 SMART
coiled coil region 558 584 N/A INTRINSIC
SH3 700 755 2.72e-18 SMART
SH3 774 831 9.32e-17 SMART
low complexity region 845 858 N/A INTRINSIC
SH3 880 937 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165212
SMART Domains Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 193 239 1.07e-26 SMART
SH3 486 541 2.72e-18 SMART
SH3 560 617 9.32e-17 SMART
low complexity region 631 644 N/A INTRINSIC
SH3 666 723 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165469
SMART Domains Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 75 93 N/A INTRINSIC
Sorb 233 279 1.07e-26 SMART
SH3 476 531 2.72e-18 SMART
SH3 550 607 9.32e-17 SMART
low complexity region 621 634 N/A INTRINSIC
SH3 656 713 3.7e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224227
Predicted Effect probably benign
Transcript: ENSMUST00000224247
Predicted Effect probably damaging
Transcript: ENSMUST00000224667
AA Change: G940R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225148
Predicted Effect probably benign
Transcript: ENSMUST00000225153
Predicted Effect probably benign
Transcript: ENSMUST00000225786
Predicted Effect probably benign
Transcript: ENSMUST00000226047
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Sorbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sorbs1 APN 19 40318029 missense probably damaging 1.00
IGL00776:Sorbs1 APN 19 40344351 splice site probably null
IGL00788:Sorbs1 APN 19 40337043 splice site probably benign
IGL00943:Sorbs1 APN 19 40295040 utr 3 prime probably benign
IGL01525:Sorbs1 APN 19 40349978 missense probably damaging 1.00
IGL01530:Sorbs1 APN 19 40376647 missense probably benign 0.01
IGL01951:Sorbs1 APN 19 40318016 splice site probably benign
IGL02159:Sorbs1 APN 19 40327596 missense probably damaging 0.96
IGL02252:Sorbs1 APN 19 40314397 missense probably damaging 1.00
IGL02613:Sorbs1 APN 19 40327547 missense probably damaging 1.00
IGL02643:Sorbs1 APN 19 40365133 missense possibly damaging 0.65
IGL02668:Sorbs1 APN 19 40314681 missense probably damaging 1.00
IGL02738:Sorbs1 APN 19 40376904 missense probably damaging 0.97
IGL02965:Sorbs1 APN 19 40376743 missense probably benign 0.01
IGL03083:Sorbs1 APN 19 40314376 missense probably damaging 1.00
IGL03173:Sorbs1 APN 19 40363262 missense probably damaging 1.00
IGL03286:Sorbs1 APN 19 40344414 missense probably damaging 0.99
IGL03292:Sorbs1 APN 19 40373565 missense possibly damaging 0.79
R0016:Sorbs1 UTSW 19 40314738 splice site probably benign
R0016:Sorbs1 UTSW 19 40314738 splice site probably benign
R0306:Sorbs1 UTSW 19 40344411 missense possibly damaging 0.94
R0526:Sorbs1 UTSW 19 40349948 missense probably damaging 1.00
R0551:Sorbs1 UTSW 19 40311816 missense probably damaging 1.00
R0688:Sorbs1 UTSW 19 40363262 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1891:Sorbs1 UTSW 19 40393460 missense probably damaging 0.99
R2066:Sorbs1 UTSW 19 40365028 splice site probably null
R2148:Sorbs1 UTSW 19 40376824 missense possibly damaging 0.94
R2214:Sorbs1 UTSW 19 40296631 missense probably damaging 1.00
R2410:Sorbs1 UTSW 19 40373515 missense probably damaging 0.99
R2940:Sorbs1 UTSW 19 40373571 missense probably damaging 1.00
R3847:Sorbs1 UTSW 19 40314443 missense probably damaging 0.97
R4405:Sorbs1 UTSW 19 40395745 missense probably benign 0.03
R4544:Sorbs1 UTSW 19 40311850 missense probably damaging 0.99
R4618:Sorbs1 UTSW 19 40373518 missense probably damaging 0.99
R4731:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4732:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4733:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4860:Sorbs1 UTSW 19 40337005 missense probably benign 0.44
R4860:Sorbs1 UTSW 19 40337005 missense probably benign 0.44
R4907:Sorbs1 UTSW 19 40340047 nonsense probably null
R4912:Sorbs1 UTSW 19 40311727 missense probably damaging 1.00
R5229:Sorbs1 UTSW 19 40340707 missense probably damaging 1.00
R5285:Sorbs1 UTSW 19 40321890 missense probably damaging 1.00
R5416:Sorbs1 UTSW 19 40376989 missense probably benign 0.06
R5706:Sorbs1 UTSW 19 40376881 missense probably benign
R5871:Sorbs1 UTSW 19 40398583 missense probably damaging 1.00
R5936:Sorbs1 UTSW 19 40324772 missense probably damaging 0.96
R6073:Sorbs1 UTSW 19 40314657 missense probably damaging 1.00
R6324:Sorbs1 UTSW 19 40321819 missense probably damaging 0.99
R6343:Sorbs1 UTSW 19 40376982 critical splice donor site probably null
R6561:Sorbs1 UTSW 19 40326052 missense probably benign
R6768:Sorbs1 UTSW 19 40327547 missense probably damaging 1.00
R6849:Sorbs1 UTSW 19 40376800 missense probably benign
R6850:Sorbs1 UTSW 19 40376800 missense probably benign
R6878:Sorbs1 UTSW 19 40376800 missense probably benign
R6879:Sorbs1 UTSW 19 40376800 missense probably benign
R6880:Sorbs1 UTSW 19 40376800 missense probably benign
R6908:Sorbs1 UTSW 19 40352332 missense probably damaging 1.00
R6980:Sorbs1 UTSW 19 40327616 nonsense probably null
R7040:Sorbs1 UTSW 19 40376800 missense probably benign
R7041:Sorbs1 UTSW 19 40376800 missense probably benign
R7110:Sorbs1 UTSW 19 40376800 missense probably benign
R7122:Sorbs1 UTSW 19 40376800 missense probably benign
R7170:Sorbs1 UTSW 19 40326129 nonsense probably null
R7180:Sorbs1 UTSW 19 40376800 missense probably benign
R7185:Sorbs1 UTSW 19 40376800 missense probably benign
R7187:Sorbs1 UTSW 19 40376800 missense probably benign
R7254:Sorbs1 UTSW 19 40376800 missense probably benign
R7255:Sorbs1 UTSW 19 40376800 missense probably benign
R7401:Sorbs1 UTSW 19 40376800 missense probably benign
R7595:Sorbs1 UTSW 19 40314653 missense probably damaging 0.99
R7819:Sorbs1 UTSW 19 40376800 missense probably benign
R7876:Sorbs1 UTSW 19 40296588 missense probably damaging 1.00
R7894:Sorbs1 UTSW 19 40327576 missense probably benign 0.02
R7986:Sorbs1 UTSW 19 40365005 missense probably damaging 0.99
R8031:Sorbs1 UTSW 19 40326489 missense probably benign 0.17
R8082:Sorbs1 UTSW 19 40365083 missense probably benign 0.08
R8282:Sorbs1 UTSW 19 40376800 missense probably benign
R8283:Sorbs1 UTSW 19 40376800 missense probably benign
R8446:Sorbs1 UTSW 19 40326158 missense probably benign
R8526:Sorbs1 UTSW 19 40376800 missense probably benign
R8527:Sorbs1 UTSW 19 40376800 missense probably benign
R8528:Sorbs1 UTSW 19 40376800 missense probably benign
R8539:Sorbs1 UTSW 19 40376800 missense probably benign
R8540:Sorbs1 UTSW 19 40376800 missense probably benign
R8542:Sorbs1 UTSW 19 40376800 missense probably benign
R8543:Sorbs1 UTSW 19 40376800 missense probably benign
R8544:Sorbs1 UTSW 19 40376800 missense probably benign
R8545:Sorbs1 UTSW 19 40376800 missense probably benign
Z1177:Sorbs1 UTSW 19 40326895 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAAGCCATGGTTAATTGCCAAG -3'
(R):5'- TGGCCAGAAAGCAGACCTTC -3'

Sequencing Primer
(F):5'- TTGCCAAGCAAAACAAACAGAAG -3'
(R):5'- AGACCTTCCCTGCCACG -3'
Posted On2018-07-24