Incidental Mutation 'R6733:Msl1'
ID530154
Institutional Source Beutler Lab
Gene Symbol Msl1
Ensembl Gene ENSMUSG00000052915
Gene Namemale specific lethal 1
Synonyms4121402D02Rik, 4930463F05Rik, 2810017F12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98795516-98807859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98800056 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 122 (E122G)
Ref Sequence ENSEMBL: ENSMUSP00000043328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000037915] [ENSMUST00000037930] [ENSMUST00000107485] [ENSMUST00000107487]
PDB Structure
CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN DOSAGE COMPENSATION FACTORS MSL1 AND MOF [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN DOSAGE COMPENSATION FACTORS MSL1 AND MSL3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000017384
SMART Domains Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037915
AA Change: E352G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042792
Gene: ENSMUSG00000052915
AA Change: E352G

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
Pfam:MSL1_dimer 216 252 5e-22 PFAM
low complexity region 289 300 N/A INTRINSIC
low complexity region 441 453 N/A INTRINSIC
PEHE 475 593 1.8e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000037930
AA Change: E122G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043328
Gene: ENSMUSG00000052915
AA Change: E122G

DomainStartEndE-ValueType
coiled coil region 18 56 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
low complexity region 211 223 N/A INTRINSIC
PEHE 229 347 2.73e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107485
AA Change: E352G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103109
Gene: ENSMUSG00000052915
AA Change: E352G

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
SCOP:d1fxkc_ 235 307 2e-3 SMART
low complexity region 441 453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107487
AA Change: E352G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103111
Gene: ENSMUSG00000052915
AA Change: E352G

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
SCOP:d1fxkc_ 235 307 6e-3 SMART
low complexity region 441 453 N/A INTRINSIC
PEHE 459 577 2.73e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126969
SMART Domains Protein: ENSMUSP00000116598
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
Pfam:PEHE 88 141 1.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153181
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Msl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Msl1 APN 11 98805421 missense probably damaging 1.00
IGL01743:Msl1 APN 11 98805419 missense probably damaging 1.00
IGL01845:Msl1 APN 11 98805365 splice site probably null
R1458:Msl1 UTSW 11 98803982 splice site probably benign
R2377:Msl1 UTSW 11 98803963 missense probably damaging 1.00
R2979:Msl1 UTSW 11 98800224 missense possibly damaging 0.91
R4135:Msl1 UTSW 11 98796300 missense possibly damaging 0.85
R4801:Msl1 UTSW 11 98803969 nonsense probably null
R4802:Msl1 UTSW 11 98803969 nonsense probably null
R5971:Msl1 UTSW 11 98798693 missense probably benign 0.30
R6079:Msl1 UTSW 11 98798693 missense probably benign 0.30
R6165:Msl1 UTSW 11 98804847 missense probably damaging 1.00
R6737:Msl1 UTSW 11 98804082 missense probably damaging 1.00
R7654:Msl1 UTSW 11 98796111 missense possibly damaging 0.72
R8316:Msl1 UTSW 11 98800248 missense probably damaging 0.98
U15987:Msl1 UTSW 11 98798693 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTAGGTACCTGGATACCTCTCTTG -3'
(R):5'- AGAAGGCTTTCTCCTTGGGG -3'

Sequencing Primer
(F):5'- AGACCGGGTTTCTCTGTAGACC -3'
(R):5'- CTCCTTGGGGTGGGTGC -3'
Posted On2018-08-01