Incidental Mutation 'R6733:Prl5a1'
ID530157
Institutional Source Beutler Lab
Gene Symbol Prl5a1
Ensembl Gene ENSMUSG00000017064
Gene Nameprolactin family 5, subfamily a, member 1
SynonymsD13Wsu14e, 1600013P04Rik, Prlpl, PLP-L
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location28142484-28151611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 28149936 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 141 (V141F)
Ref Sequence ENSEMBL: ENSMUSP00000017208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017208]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017208
AA Change: V141F

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000017208
Gene: ENSMUSG00000017064
AA Change: V141F

DomainStartEndE-ValueType
Pfam:Hormone_1 17 230 4.8e-50 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Prl5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Prl5a1 APN 13 28145439 missense possibly damaging 0.77
IGL01820:Prl5a1 APN 13 28148700 missense probably benign 0.34
IGL02682:Prl5a1 APN 13 28145420 missense probably benign 0.32
R0266:Prl5a1 UTSW 13 28149987 missense possibly damaging 0.77
R1022:Prl5a1 UTSW 13 28149897 missense probably damaging 0.97
R1024:Prl5a1 UTSW 13 28149897 missense probably damaging 0.97
R2098:Prl5a1 UTSW 13 28145505 missense probably damaging 1.00
R5467:Prl5a1 UTSW 13 28150011 missense possibly damaging 0.92
R6002:Prl5a1 UTSW 13 28145482 missense probably benign 0.00
R6026:Prl5a1 UTSW 13 28151264 missense probably benign 0.43
R6242:Prl5a1 UTSW 13 28142555 nonsense probably null
R6616:Prl5a1 UTSW 13 28149856 missense probably benign 0.00
R6979:Prl5a1 UTSW 13 28151206 missense probably benign 0.32
R7692:Prl5a1 UTSW 13 28150014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAAGCTCTGAATACTCAACTAG -3'
(R):5'- TGGCTAAATTTCGCTGTGGC -3'

Sequencing Primer
(F):5'- GCTCTGAATACTCAACTAGTTATCAC -3'
(R):5'- TCGAGACAGAGTTTAGCCCTG -3'
Posted On2018-08-01