Incidental Mutation 'R6733:Olfr1447'
ID530164
Institutional Source Beutler Lab
Gene Symbol Olfr1447
Ensembl Gene ENSMUSG00000060303
Gene Nameolfactory receptor 1447
SynonymsGA_x6K02T2RE5P-3231251-3230331, MOR202-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location12899434-12903743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12901241 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 180 (C180S)
Ref Sequence ENSEMBL: ENSMUSP00000149392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071484] [ENSMUST00000208343] [ENSMUST00000216989]
Predicted Effect probably damaging
Transcript: ENSMUST00000071484
AA Change: C180S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071419
Gene: ENSMUSG00000060303
AA Change: C180S

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 5.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 306 2.1e-7 PFAM
Pfam:7tm_1 42 291 7.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208343
Predicted Effect probably damaging
Transcript: ENSMUST00000216989
AA Change: C180S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220222
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Olfr1447
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Olfr1447 APN 19 12901355 missense probably benign 0.40
IGL01704:Olfr1447 APN 19 12901739 missense probably benign 0.01
IGL01767:Olfr1447 APN 19 12901748 missense probably benign 0.12
IGL01969:Olfr1447 APN 19 12901052 missense possibly damaging 0.69
IGL02435:Olfr1447 APN 19 12901027 missense probably damaging 1.00
IGL02666:Olfr1447 APN 19 12900857 missense probably benign
IGL03034:Olfr1447 APN 19 12901757 missense possibly damaging 0.94
IGL03221:Olfr1447 APN 19 12901541 missense probably damaging 1.00
R0315:Olfr1447 UTSW 19 12901234 missense possibly damaging 0.66
R0550:Olfr1447 UTSW 19 12901800 splice site probably null
R0729:Olfr1447 UTSW 19 12900895 missense probably damaging 0.97
R1381:Olfr1447 UTSW 19 12900956 missense probably benign 0.00
R1669:Olfr1447 UTSW 19 12901288 missense possibly damaging 0.79
R1775:Olfr1447 UTSW 19 12901235 missense probably benign 0.02
R1918:Olfr1447 UTSW 19 12900851 makesense probably null
R2377:Olfr1447 UTSW 19 12900853 missense possibly damaging 0.45
R2406:Olfr1447 UTSW 19 12901627 missense probably benign 0.11
R2471:Olfr1447 UTSW 19 12901315 missense probably benign 0.00
R2484:Olfr1447 UTSW 19 12901641 missense probably benign 0.06
R2656:Olfr1447 UTSW 19 12901666 missense probably benign 0.37
R3888:Olfr1447 UTSW 19 12901133 missense probably benign 0.00
R4250:Olfr1447 UTSW 19 12901004 missense probably benign 0.09
R4545:Olfr1447 UTSW 19 12901268 nonsense probably null
R4895:Olfr1447 UTSW 19 12900887 missense probably damaging 1.00
R4956:Olfr1447 UTSW 19 12901599 missense probably damaging 0.99
R4991:Olfr1447 UTSW 19 12901451 missense probably damaging 0.98
R5044:Olfr1447 UTSW 19 12901001 missense probably damaging 1.00
R5165:Olfr1447 UTSW 19 12901200 missense probably benign 0.00
R6025:Olfr1447 UTSW 19 12901670 missense probably benign 0.10
R6135:Olfr1447 UTSW 19 12901439 missense probably damaging 0.97
R6459:Olfr1447 UTSW 19 12901005 missense possibly damaging 0.94
R6789:Olfr1447 UTSW 19 12901289 missense probably benign 0.21
R6923:Olfr1447 UTSW 19 12901312 missense probably benign 0.04
R7310:Olfr1447 UTSW 19 12901273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGGTGGATATAGCCTTG -3'
(R):5'- CTGTGGAGAACTATCTGTTGGCC -3'

Sequencing Primer
(F):5'- ATATAGCCTTGTGATGTCCTGAAGC -3'
(R):5'- CAATGGCCTATGATCGCTATGCAG -3'
Posted On2018-08-01