Incidental Mutation 'R6733:Psg20'
ID530141
Institutional Source Beutler Lab
Gene Symbol Psg20
Ensembl Gene ENSMUSG00000063305
Gene Namepregnancy-specific glycoprotein 20
Synonymscea7, EG434540
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location18674107-18686185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18674622 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 391 (V391D)
Ref Sequence ENSEMBL: ENSMUSP00000075973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076677] [ENSMUST00000108482]
Predicted Effect probably damaging
Transcript: ENSMUST00000076677
AA Change: V391D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075973
Gene: ENSMUSG00000063305
AA Change: V391D

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 280 381 8.01e-3 SMART
IGc2 397 461 1.47e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108482
AA Change: V388D

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104122
Gene: ENSMUSG00000063305
AA Change: V388D

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 277 378 8.01e-3 SMART
IGc2 394 458 1.47e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Psg20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Psg20 APN 7 18674611 missense possibly damaging 0.72
IGL01459:Psg20 APN 7 18682713 missense probably damaging 1.00
IGL01599:Psg20 APN 7 18681038 missense possibly damaging 0.83
IGL01678:Psg20 APN 7 18680870 missense probably damaging 1.00
IGL01991:Psg20 APN 7 18684425 missense probably benign 0.01
IGL02449:Psg20 APN 7 18684408 splice site probably benign
IGL02522:Psg20 APN 7 18682431 missense probably benign 0.06
IGL03358:Psg20 APN 7 18680966 missense probably benign 0.04
PIT4431001:Psg20 UTSW 7 18674550 missense probably damaging 1.00
R0136:Psg20 UTSW 7 18682507 missense probably damaging 0.98
R0184:Psg20 UTSW 7 18685976 missense probably null 0.95
R0894:Psg20 UTSW 7 18681044 nonsense probably null
R1291:Psg20 UTSW 7 18684674 missense possibly damaging 0.46
R1997:Psg20 UTSW 7 18682610 missense probably benign 0.00
R2118:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2119:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2120:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2121:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2124:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2127:Psg20 UTSW 7 18682718 missense probably damaging 0.99
R3795:Psg20 UTSW 7 18684449 missense probably benign 0.09
R4115:Psg20 UTSW 7 18685980 missense probably damaging 1.00
R4238:Psg20 UTSW 7 18684509 missense probably damaging 1.00
R5004:Psg20 UTSW 7 18680912 missense probably damaging 1.00
R5025:Psg20 UTSW 7 18674366 makesense probably null
R6294:Psg20 UTSW 7 18682679 missense probably damaging 1.00
R6744:Psg20 UTSW 7 18674580 missense probably damaging 1.00
R6799:Psg20 UTSW 7 18684420 missense probably benign 0.06
R7466:Psg20 UTSW 7 18684467 missense probably benign 0.00
R7524:Psg20 UTSW 7 18684659 missense probably benign 0.18
R7583:Psg20 UTSW 7 18682483 missense probably damaging 1.00
R7941:Psg20 UTSW 7 18681177 critical splice acceptor site probably null
R8010:Psg20 UTSW 7 18681067 missense probably benign 0.06
R8247:Psg20 UTSW 7 18682637 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACATTGGTACTCTCCAGCATC -3'
(R):5'- CAACCTCAGTGGCTGAATCAG -3'

Sequencing Primer
(F):5'- AGCATCCTCCTTCCTCACAGTATG -3'
(R):5'- CTCAGTGGCTGAATCAGGATCATAC -3'
Posted On2018-08-01