Incidental Mutation 'R6797:Gramd1b'
ID533055
Institutional Source Beutler Lab
Gene Symbol Gramd1b
Ensembl Gene ENSMUSG00000040111
Gene NameGRAM domain containing 1B
SynonymsA930008A22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location40293233-40531383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40308406 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 324 (I324T)
Ref Sequence ENSEMBL: ENSMUSP00000148890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045682] [ENSMUST00000118159] [ENSMUST00000119373] [ENSMUST00000121357] [ENSMUST00000165104] [ENSMUST00000211853] [ENSMUST00000216821]
Predicted Effect probably benign
Transcript: ENSMUST00000045682
AA Change: I468T

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048126
Gene: ENSMUSG00000040111
AA Change: I468T

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
low complexity region 123 141 N/A INTRINSIC
low complexity region 203 226 N/A INTRINSIC
GRAM 240 307 1.54e-28 SMART
low complexity region 375 385 N/A INTRINSIC
Pfam:DUF4782 519 667 1.6e-38 PFAM
low complexity region 696 710 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118159
AA Change: I284T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112417
Gene: ENSMUSG00000040111
AA Change: I284T

DomainStartEndE-ValueType
low complexity region 19 42 N/A INTRINSIC
GRAM 56 123 1.54e-28 SMART
low complexity region 191 201 N/A INTRINSIC
low complexity region 512 526 N/A INTRINSIC
transmembrane domain 584 606 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119373
AA Change: I351T
SMART Domains Protein: ENSMUSP00000112489
Gene: ENSMUSG00000040111
AA Change: I351T

DomainStartEndE-ValueType
low complexity region 9 24 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
GRAM 126 193 1.54e-28 SMART
low complexity region 261 271 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
transmembrane domain 654 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121357
AA Change: I320T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112564
Gene: ENSMUSG00000040111
AA Change: I320T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 55 78 N/A INTRINSIC
GRAM 92 159 1.54e-28 SMART
low complexity region 227 237 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
transmembrane domain 620 642 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137454
AA Change: I78T
SMART Domains Protein: ENSMUSP00000116871
Gene: ENSMUSG00000040111
AA Change: I78T

DomainStartEndE-ValueType
Pfam:DUF4782 130 278 2.3e-39 PFAM
low complexity region 307 321 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165104
AA Change: I468T

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130050
Gene: ENSMUSG00000040111
AA Change: I468T

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
low complexity region 123 141 N/A INTRINSIC
low complexity region 203 226 N/A INTRINSIC
GRAM 240 307 1.54e-28 SMART
low complexity region 375 385 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211853
AA Change: I353T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000216821
AA Change: I324T

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Gramd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gramd1b APN 9 40310041 missense probably damaging 0.97
IGL00575:Gramd1b APN 9 40327411 splice site probably benign
IGL01596:Gramd1b APN 9 40303513 missense probably damaging 1.00
IGL01810:Gramd1b APN 9 40315773 missense probably damaging 1.00
IGL02148:Gramd1b APN 9 40315764 missense probably damaging 1.00
IGL02206:Gramd1b APN 9 40300032 missense probably benign 0.01
IGL02626:Gramd1b APN 9 40298010 missense probably damaging 0.98
IGL02723:Gramd1b APN 9 40306831 missense probably damaging 0.97
IGL03192:Gramd1b APN 9 40306801 missense probably damaging 1.00
I2288:Gramd1b UTSW 9 40306805 missense probably damaging 0.97
PIT4283001:Gramd1b UTSW 9 40455456 missense probably benign 0.01
R0038:Gramd1b UTSW 9 40317526 missense probably damaging 1.00
R0038:Gramd1b UTSW 9 40317526 missense probably damaging 1.00
R0600:Gramd1b UTSW 9 40308355 missense probably damaging 1.00
R1290:Gramd1b UTSW 9 40316821 splice site probably null
R1637:Gramd1b UTSW 9 40304538 splice site probably null
R1782:Gramd1b UTSW 9 40413337 missense probably damaging 1.00
R1928:Gramd1b UTSW 9 40306469 missense possibly damaging 0.70
R3620:Gramd1b UTSW 9 40455546 missense probably benign 0.01
R3943:Gramd1b UTSW 9 40531044 start codon destroyed probably null
R4613:Gramd1b UTSW 9 40307993 missense probably damaging 1.00
R4740:Gramd1b UTSW 9 40315832 splice site probably null
R4808:Gramd1b UTSW 9 40304349 missense possibly damaging 0.58
R5407:Gramd1b UTSW 9 40455655 missense probably damaging 0.97
R6209:Gramd1b UTSW 9 40333650 missense probably damaging 1.00
R7103:Gramd1b UTSW 9 40401606 missense unknown
R7185:Gramd1b UTSW 9 40333563 missense probably benign 0.03
R7352:Gramd1b UTSW 9 40307993 missense probably damaging 1.00
R7409:Gramd1b UTSW 9 40327431 missense probably damaging 1.00
R7561:Gramd1b UTSW 9 40401615 missense unknown
R8272:Gramd1b UTSW 9 40304524 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAGACATGTTGCAAAACGG -3'
(R):5'- CCCTTTGGAGAGATGATCCACAG -3'

Sequencing Primer
(F):5'- GAGAGGTGAAGGGGGTTCTCC -3'
(R):5'- AGTTTGCATGACCAATGGGCC -3'
Posted On2018-08-29