Incidental Mutation 'R6797:Olfr748'
ID533069
Institutional Source Beutler Lab
Gene Symbol Olfr748
Ensembl Gene ENSMUSG00000060084
Gene Nameolfactory receptor 748
SynonymsGA_x6K02T2PMLR-6454789-6455712, MOR106-9P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50707373-50713797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50711106 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 259 (Y259N)
Ref Sequence ENSEMBL: ENSMUSP00000149491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073561] [ENSMUST00000213101]
Predicted Effect probably damaging
Transcript: ENSMUST00000073561
AA Change: Y259N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073251
Gene: ENSMUSG00000060084
AA Change: Y259N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-52 PFAM
Pfam:7tm_1 41 290 2.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213101
AA Change: Y259N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Olfr748
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Olfr748 APN 14 50710993 missense possibly damaging 0.95
IGL02965:Olfr748 APN 14 50711196 missense probably damaging 1.00
R0576:Olfr748 UTSW 14 50711204 missense probably damaging 0.98
R1184:Olfr748 UTSW 14 50710614 missense probably benign 0.01
R2129:Olfr748 UTSW 14 50710636 missense probably damaging 0.99
R2895:Olfr748 UTSW 14 50710516 missense probably damaging 0.99
R2896:Olfr748 UTSW 14 50710516 missense probably damaging 0.99
R4017:Olfr748 UTSW 14 50710876 missense probably benign 0.03
R5053:Olfr748 UTSW 14 50710511 nonsense probably null
R5057:Olfr748 UTSW 14 50711212 missense probably damaging 1.00
R5113:Olfr748 UTSW 14 50710914 missense probably benign 0.00
R5294:Olfr748 UTSW 14 50710443 missense possibly damaging 0.95
R5294:Olfr748 UTSW 14 50710779 missense probably benign 0.01
R5499:Olfr748 UTSW 14 50710867 missense probably damaging 1.00
R5582:Olfr748 UTSW 14 50710968 missense probably damaging 1.00
R5727:Olfr748 UTSW 14 50710360 missense possibly damaging 0.74
R7685:Olfr748 UTSW 14 50710758 missense possibly damaging 0.95
R7717:Olfr748 UTSW 14 50710762 missense probably damaging 1.00
R7778:Olfr748 UTSW 14 50710471 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AATGGTCCTGTCCTGTACCC -3'
(R):5'- GTGTCCCATAGTCAGGTAATAAAAC -3'

Sequencing Primer
(F):5'- TACACCCATCATAAGGCATGTATTC -3'
(R):5'- CCCTATTTGTTAGTTTTGCATAATCC -3'
Posted On2018-08-29