Incidental Mutation 'R6852:Ttll3'
ID535020
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Nametubulin tyrosine ligase-like family, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6852 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location113389260-113414587 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAAAGTAA to CAAAGTAAAGTAA at 113399157 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000204026] [ENSMUST00000205017]
Predicted Effect probably benign
Transcript: ENSMUST00000032414
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038889
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203524
Predicted Effect probably null
Transcript: ENSMUST00000204026
SMART Domains Protein: ENSMUSP00000145049
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,169 Q40* probably null Het
1700034E13Rik T C 18: 52,663,633 V81A probably damaging Het
2310035C23Rik T C 1: 105,753,595 L1184P probably damaging Het
5330417C22Rik T C 3: 108,482,338 E203G probably damaging Het
9530053A07Rik T A 7: 28,147,135 I1084N probably damaging Het
A630089N07Rik A G 16: 98,065,655 I369T probably benign Het
Aatk T A 11: 120,010,468 Q977L probably benign Het
Abca4 A T 3: 122,135,195 Q144H probably damaging Het
Ampd3 T C 7: 110,802,546 F416L probably benign Het
Anks1b A G 10: 90,260,654 E425G probably damaging Het
Atm A G 9: 53,482,430 S1737P possibly damaging Het
Bsph1 T A 7: 13,470,330 probably null Het
Cabyr C T 18: 12,754,097 P262S probably benign Het
Cdc14a G A 3: 116,328,676 P214L possibly damaging Het
Cep128 C A 12: 91,366,342 probably null Het
Cfh T A 1: 140,147,749 R250S probably damaging Het
Ddx39 T C 8: 83,723,017 I417T probably benign Het
Dgka T A 10: 128,722,539 K548M probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Epg5 C T 18: 78,012,891 T1760I probably damaging Het
Fat1 T C 8: 45,035,598 V3472A possibly damaging Het
Fbxo48 T A 11: 16,953,402 N9K probably benign Het
Fer1l6 A T 15: 58,594,878 H833L probably damaging Het
Foxn1 G T 11: 78,360,960 Q482K probably benign Het
Fstl5 A G 3: 76,707,855 D741G probably damaging Het
Gm8909 T C 17: 36,168,073 N95D possibly damaging Het
Gmip C T 8: 69,817,991 Q55* probably null Het
Hapln2 G A 3: 88,022,651 T306M possibly damaging Het
Kat6a T A 8: 22,938,660 S1344T probably benign Het
Kctd1 C T 18: 14,986,344 D705N possibly damaging Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Micall2 G T 5: 139,715,793 A482D possibly damaging Het
Mindy3 T A 2: 12,419,252 M1L possibly damaging Het
Mtdh A G 15: 34,136,721 E352G probably damaging Het
Muc5ac G A 7: 141,816,907 V3219I probably benign Het
Myh4 A G 11: 67,252,968 probably null Het
Ncor1 A G 11: 62,343,245 I377T probably damaging Het
Olfr1034 A T 2: 86,046,604 I41F probably benign Het
Oog4 C A 4: 143,439,109 C156F possibly damaging Het
Pcyt1a T C 16: 32,470,120 S260P probably damaging Het
Phf3 A T 1: 30,804,630 F1749L probably damaging Het
Prickle2 T C 6: 92,376,544 D647G probably benign Het
Raver2 T C 4: 101,133,590 S387P probably benign Het
Rgs19 A G 2: 181,689,148 S231P possibly damaging Het
Rpl8 G T 15: 76,905,949 R198L probably benign Het
Sacs T A 14: 61,179,288 S77T possibly damaging Het
Samd14 G A 11: 95,021,454 G219D probably damaging Het
Sec16a C T 2: 26,441,419 V195M probably damaging Het
Sesn2 C T 4: 132,493,802 V453I possibly damaging Het
Slc46a3 A T 5: 147,886,160 C291S probably damaging Het
Smarcal1 A G 1: 72,591,173 T129A possibly damaging Het
Sorl1 T A 9: 42,024,398 R1041W possibly damaging Het
Sptlc3 T C 2: 139,566,586 I207T probably benign Het
Srgap3 T C 6: 112,816,661 D118G probably damaging Het
Tas2r117 T A 6: 132,802,929 V10D probably benign Het
Tbcd A G 11: 121,609,380 K1111E probably benign Het
Tor1aip1 A T 1: 156,035,820 L139Q probably damaging Het
Trbv23 T C 6: 41,216,247 V23A probably damaging Het
Vmn1r42 T G 6: 89,844,787 T267P possibly damaging Het
Vmn2r53 C A 7: 12,606,514 V11F probably damaging Het
Vmn2r67 T C 7: 85,152,153 M192V probably damaging Het
Vmn2r78 T C 7: 86,954,603 V663A probably damaging Het
Zdhhc1 C T 8: 105,477,072 G156S possibly damaging Het
Zfp318 GAAGAA GAAGAAAAAGAA 17: 46,412,533 probably benign Het
Zfp318 AAGAAG AAGAAGTAGAAG 17: 46,412,534 probably benign Het
Zfp318 AGAAG AGAAGAGGAAG 17: 46,412,538 probably benign Het
Zfp560 A G 9: 20,348,043 C508R probably damaging Het
Zfp654 G A 16: 64,786,598 L414F probably damaging Het
Zfp872 A T 9: 22,200,059 Y278F probably damaging Het
Zscan20 T C 4: 128,589,722 S385G probably damaging Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113394729 missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113412984 missense probably benign
IGL01697:Ttll3 APN 6 113399729 missense probably benign 0.00
IGL01944:Ttll3 APN 6 113414115 missense probably benign
IGL02688:Ttll3 APN 6 113399739 missense probably benign 0.00
IGL03068:Ttll3 APN 6 113409197 missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113398777 missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113409339 missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113408903 critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113392764 missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113398770 missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113409042 missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113412934 missense probably benign 0.31
R2896:Ttll3 UTSW 6 113392722 missense probably benign 0.15
R2903:Ttll3 UTSW 6 113407323 missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113392510 unclassified probably benign
R4659:Ttll3 UTSW 6 113414141 missense probably benign
R4746:Ttll3 UTSW 6 113407392 missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113412940 missense probably benign 0.00
R5358:Ttll3 UTSW 6 113401331 missense probably benign 0.26
R5372:Ttll3 UTSW 6 113401421 nonsense probably null
R5525:Ttll3 UTSW 6 113412978 missense probably benign
R5548:Ttll3 UTSW 6 113393117 missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113399708 missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113398031 nonsense probably null
R6119:Ttll3 UTSW 6 113394741 missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113392563 missense probably benign 0.00
R6719:Ttll3 UTSW 6 113399032 intron probably benign
R6852:Ttll3 UTSW 6 113399155 frame shift probably null
R6852:Ttll3 UTSW 6 113399159 frame shift probably null
R6853:Ttll3 UTSW 6 113399157 frame shift probably null
R6854:Ttll3 UTSW 6 113399157 frame shift probably null
R7170:Ttll3 UTSW 6 113413878 missense probably benign 0.41
R7239:Ttll3 UTSW 6 113399157 frame shift probably null
R7302:Ttll3 UTSW 6 113409285 missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399164 frame shift probably null
R7586:Ttll3 UTSW 6 113399157 frame shift probably null
R7587:Ttll3 UTSW 6 113399157 frame shift probably null
R7701:Ttll3 UTSW 6 113399157 frame shift probably null
R7702:Ttll3 UTSW 6 113399157 frame shift probably null
R7774:Ttll3 UTSW 6 113399160 frame shift probably null
R7775:Ttll3 UTSW 6 113399158 nonsense probably null
R7775:Ttll3 UTSW 6 113399160 frame shift probably null
R7776:Ttll3 UTSW 6 113399159 frame shift probably null
R7793:Ttll3 UTSW 6 113399158 frame shift probably null
R7793:Ttll3 UTSW 6 113399159 frame shift probably null
R7797:Ttll3 UTSW 6 113394777 missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113399157 frame shift probably null
R7824:Ttll3 UTSW 6 113399161 frame shift probably null
R7824:Ttll3 UTSW 6 113399164 frame shift probably null
R7825:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399157 frame shift probably null
R7826:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399160 frame shift probably null
R7826:Ttll3 UTSW 6 113399161 frame shift probably null
R7827:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399162 frame shift probably null
R7831:Ttll3 UTSW 6 113399155 frame shift probably null
R7831:Ttll3 UTSW 6 113399157 frame shift probably null
R7831:Ttll3 UTSW 6 113399159 frame shift probably null
R7832:Ttll3 UTSW 6 113399155 frame shift probably null
R7832:Ttll3 UTSW 6 113399157 frame shift probably null
R7833:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
R7914:Ttll3 UTSW 6 113399157 frame shift probably null
R7915:Ttll3 UTSW 6 113399157 frame shift probably null
R7916:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAGCAAGCCTCCCCTTG -3'
(R):5'- GGCCTGGACCAGTTTCATTTC -3'

Sequencing Primer
(F):5'- TGTGGCCTCTGTAACCCCAG -3'
(R):5'- GCTGCCTTGGAACTCACTATGAAG -3'
Posted On2018-09-12