Incidental Mutation 'R6887:Chrna5'
List |< first << previous [record 12 of 40] next >> last >|
ID536998
Institutional Source Beutler Lab
Gene Symbol Chrna5
Ensembl Gene ENSMUSG00000035594
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 5
SynonymsAcra-5, Acra5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location54980880-55007779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55005133 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 302 (V302L)
Ref Sequence ENSEMBL: ENSMUSP00000149366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034851] [ENSMUST00000093844] [ENSMUST00000213960] [ENSMUST00000217408]
Predicted Effect probably benign
Transcript: ENSMUST00000034851
SMART Domains Protein: ENSMUSP00000034851
Gene: ENSMUSG00000032303

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 34 240 6.1e-77 PFAM
Pfam:Neur_chan_memb 247 494 7.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093844
AA Change: V377L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091365
Gene: ENSMUSG00000035594
AA Change: V377L

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 18 221 4.9e-72 PFAM
Pfam:Neur_chan_memb 228 352 1.9e-51 PFAM
Pfam:Neur_chan_memb 338 417 1.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213960
AA Change: V406L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217408
AA Change: V302L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. These receptors are thought to be heteropentamers composed of separate but similar subunits. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are less sensitive to nicotine-induced seizures than wild-type controls and exhibit a significantly shorter latency time to seizure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Chrna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Chrna5 APN 9 55004399 missense possibly damaging 0.61
IGL01503:Chrna5 APN 9 54998171 intron probably benign
IGL01617:Chrna5 APN 9 55005013 missense probably damaging 0.98
IGL01935:Chrna5 APN 9 55004843 missense probably benign 0.01
IGL02613:Chrna5 APN 9 55006421 missense probably damaging 0.99
IGL03248:Chrna5 APN 9 55004639 missense probably damaging 1.00
IGL03412:Chrna5 APN 9 55004435 missense probably damaging 1.00
R0712:Chrna5 UTSW 9 55004363 missense probably damaging 1.00
R1619:Chrna5 UTSW 9 55004365 missense probably benign 0.00
R1698:Chrna5 UTSW 9 55004642 missense probably damaging 1.00
R1789:Chrna5 UTSW 9 55004651 missense possibly damaging 0.94
R1800:Chrna5 UTSW 9 55004875 missense probably damaging 0.99
R4028:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4030:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4031:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4201:Chrna5 UTSW 9 54998075 missense probably benign 0.00
R4792:Chrna5 UTSW 9 55004701 missense probably damaging 1.00
R5196:Chrna5 UTSW 9 55006519 missense possibly damaging 0.91
R5718:Chrna5 UTSW 9 54998105 missense probably benign 0.00
R5779:Chrna5 UTSW 9 54998104 missense probably benign 0.35
R6254:Chrna5 UTSW 9 55006456 missense probably benign 0.00
R6492:Chrna5 UTSW 9 54998063 missense probably benign 0.11
R6986:Chrna5 UTSW 9 55006457 missense possibly damaging 0.83
R7056:Chrna5 UTSW 9 54981701 intron probably benign
R7222:Chrna5 UTSW 9 54998063 missense probably benign 0.11
R7384:Chrna5 UTSW 9 55004833 missense probably damaging 1.00
R7572:Chrna5 UTSW 9 55006465 missense probably damaging 1.00
R7653:Chrna5 UTSW 9 55002434 missense probably benign
R7846:Chrna5 UTSW 9 55005107 missense probably benign 0.38
Z1176:Chrna5 UTSW 9 55004482 missense probably damaging 1.00
Z1177:Chrna5 UTSW 9 55004956 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GGTGACTGTCTTTGCCATCAAC -3'
(R):5'- TATTCCAGAGCCAAAGAACTAAGTC -3'

Sequencing Primer
(F):5'- ACAATGCTATGGCGCCGTG -3'
(R):5'- CAAGATGCTCTGGGGAAA -3'
Posted On2018-10-18